Usage Restrictions
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested. (see references)
For a commercial use of this resource, a new contract must be concluded between the depositor and the RECIPIENT.
The RECIPIENT recognizes and acknowledges that the BIOLOGICAL RESOURCE was created by the scientist at KYOTO UNIVERSITY from Nanog-IRES-Puro mouse by utilizing the Red/ET Recombineering technology of Gene Bridges GmBH.
Origin
mouse Nanog-GFP IRES puromycin resistant BAC was injected into Crlj:WI rat embryos. 4 lines were established of which line 22 showed the best breeding performance
Strain characteristics
Nanog-GFP IRES puro-resistance transgene was generated by insertion of GFP-IRES-puromycin resistance gene (Puror) cassette into the 5' untranslated region of a bacterial artificial chromosome (BAC) containing the mouse Nanog gene. ES and iPS cells with the Nanog-GFP transgene are positive for GFP.
Breeding Conditions
normal breeding performance
Genotyping
mouse nanog-GFP BAC can be detected using the following primer pair:
PHF5’BamH1 TGGGATCCCTATGCTACTCCGTCGAAGTTC
6047AS10 CTAGGCAAACTGTGGGGACCAGGAAGAC
Annealing 63°C; 30 cycles standard PCR conditions
References
Okita, K. et al., Generation of germline-competent induced pluripotent stem cells. Nature 448: 313-317(2007)