NBRP Rat No: 0637 |
Strain name: F344.W-Tg(Nanog-GFP,-PuroR)Kyo |
Commmon Name: nanog-GFP reporter rat |
Rat Genome Database |
Principal Investigator: |
Birger Voigt Graduate School of Medicine, Kyoto University Yoshidakonoe-cho, Sakyo-ku 606-8501 Kyoto JAPAN |
Tel: 075-753-9318 Fax: 075-753-4409 |
Email: birger@anim.med.kyoto-u.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
albino (A,B,c,h) |
Inbred Generations |
N7 (April 2012) |
Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested. (see references) For a commercial use of this resource, a new contract must be concluded between the depositor and the RECIPIENT. The RECIPIENT recognizes and acknowledges that the BIOLOGICAL RESOURCE was created by the scientist at KYOTO UNIVERSITY from Nanog-IRES-Puro mouse by utilizing the Red/ET Recombineering technology of Gene Bridges GmBH. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Nanog |
Origin |
W-Tg(Nanog-GFP,-puro-r)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic background |
Strain characteristics |
Nanog-GFP IRES puro-resistance transgene was generated by insertion of GFP-IRES-puromycin resistance gene (Puror) cassette into the 5' untranslated region of a bacterial artificial chromosome (BAC) containing the mouse Nanog gene. ES and iPS cells with the Nanog-GFP transgene are positive for GFP. |
Breeding Conditions |
normal breeding performance |
Genotyping |
mouse nanog-GFP BAC can be detected using the following primer pair:
PHF5’BamH1 TGGGATCCCTATGCTACTCCGTCGAAGTTC
6047AS10 CTAGGCAAACTGTGGGGACCAGGAAGAC
Annealing 63°C; 30 cycles standard PCR conditions |
References |
Okita, K. et al., Generation of germline-competent induced pluripotent stem cells. Nature 448: 313-317(2007) |
Additional strain information |
|
|