Strain information
 NBRP Rat No: 0637  Strain name: F344.W-Tg(Nanog-GFP,-PuroR)Kyo  Commmon Name: nanog-GFP reporter rat Rat Genome Database
Principal Investigator:  Birger Voigt   Graduate School of Medicine, Kyoto University        Yoshidakonoe-cho, Sakyo-ku    606-8501 Kyoto     JAPAN
Tel: 075-753-9318    Fax: 075-753-4409 Email: birger@anim.med.kyoto-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino (A,B,c,h)
Inbred Generations  N7 (April 2012)
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested. (see references)
For a commercial use of this resource, a new contract must be concluded between the depositor and the RECIPIENT.
The RECIPIENT recognizes and acknowledges that the BIOLOGICAL RESOURCE was created by the scientist at KYOTO UNIVERSITY from Nanog-IRES-Puro mouse by utilizing the Red/ET Recombineering technology of Gene Bridges GmBH.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Nanog
Origin W-Tg(Nanog-GFP,-puro-r)/22Kyo rats were backcrossed to F344/Stm to transfer the transgene onto a different genetic background
Strain characteristics Nanog-GFP IRES puro-resistance transgene was generated by insertion of GFP-IRES-puromycin resistance gene (Puror) cassette into the 5' untranslated region of a bacterial artificial chromosome (BAC) containing the mouse Nanog gene. ES and iPS cells with the Nanog-GFP transgene are positive for GFP.
Breeding Conditions normal breeding performance
Genotyping mouse nanog-GFP BAC can be detected using the following primer pair: PHF5’BamH1 TGGGATCCCTATGCTACTCCGTCGAAGTTC 6047AS10 CTAGGCAAACTGTGGGGACCAGGAAGAC Annealing 63°C; 30 cycles standard PCR conditions
References Okita, K. et al., Generation of germline-competent induced pluripotent stem cells. Nature 448: 313-317(2007)
Additional strain information