Strain information

Back to the list 560 / 882

NBRP Rat No: 0646

Strain name: F344-Prkdc^em1Kyo

Commmon Name: SCID

Rat Genome Database

Principal Investigator:

Tomoji Mashimo The University of Tokyo, The Institute of Medical Science

Preservation Status:

Embryo Sperm Living Animals

Coat Color

albino (c)

Inbred Generations

F3(March 2012)

Usage Restrictions

The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.

Genetic Status

Inbred Segregating Congenic Consomic Recombinant Coisogenic Spont. Mutant Transgene Ind. Mutant Category Other

Comercial Availability

Research Category

Diabetes Obesity Neurobiology Ophthalmology Dentistry Cardio Hypertension Cancer Metabolism Otorhinology Immunology Infectious Osteosis Internal Organ Dermatology Reproduction Development Behavior Hematology Urology Pharmacology Research Area Others

Control Strain Marker Strain

Gene Affected

Origin

This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene. Background strain: F344/Stm

Strain characteristics

This strain shows severe combined immunodeficiency（SCID） caused by a 46-bp deletion in the exon 1 of Prkdc gene.

Breeding Conditions

maintained by breeding between homozygous rats

Genotyping

Primers for Prkdc: CTTGCGGTGCTGGCTACTAC and TTCCCTCTTGTACTCTCATCCAA. wild: 309-bp, mutant: 263-bp.

References

Mashimo T, Takizawa A, Kobayashi J, Kunihiro Y, Yoshimi K, Ishida S, Tanabe K, Yanagi A, Tachibana A, Hirose J, Yomoda J, Morimoto S, Kuramoto T, Voigt B, Watanabe T, Hiai H, Tateno C, Komatsu K, Serikawa T.
Generation and characterization of severe combined immunodeficiency rats.
Cell Rep. 2012 Sep 27;2(3):685-94.

Additional strain information (Japanese only)