| NBRP Rat No: 0646 |
Strain name: F344-Prkdcem1Kyo |
Commmon Name: SCID |
Rat Genome Database |
| Principal Investigator: |
Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan |
| Tel: 03-6409-2489 Fax: |
Email: mashimo@ims.u-tokyo.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
albino (c) |
| Inbred Generations |
F3(March 2012) |
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
|
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
|
| Origin |
This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene. Background strain: F344/Stm |
| Strain characteristics |
This strain shows severe combined immunodeficiency(SCID) caused by a 46-bp deletion in the exon 1 of Prkdc gene. |
| Breeding Conditions |
maintained by breeding between homozygous rats |
| Genotyping |
Primers for Prkdc: CTTGCGGTGCTGGCTACTAC and TTCCCTCTTGTACTCTCATCCAA. wild: 309-bp, mutant: 263-bp. |
| References |
Mashimo T, Takizawa A, Kobayashi J, Kunihiro Y, Yoshimi K, Ishida S, Tanabe K, Yanagi A, Tachibana A, Hirose J, Yomoda J, Morimoto S, Kuramoto T, Voigt B, Watanabe T, Hiai H, Tateno C, Komatsu K, Serikawa T.
Generation and characterization of severe combined immunodeficiency rats.
Cell Rep. 2012 Sep 27;2(3):685-94.
|
| Additional strain information |
|
|