Strain information  NBRP Rat No: 0646  Strain name: F344-Prkdcem1Kyo  Commmon Name: SCID Rat Genome Database Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color  albino (c) Inbred Generations  F3(March 2012) Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected Origin This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene. Background strain: F344/Stm Strain characteristics This strain shows severe combined immunodeficiency（SCID） caused by a 46-bp deletion in the exon 1 of Prkdc gene. Breeding Conditions maintained by breeding between homozygous rats Genotyping Primers for Prkdc: CTTGCGGTGCTGGCTACTAC and TTCCCTCTTGTACTCTCATCCAA. wild: 309-bp, mutant: 263-bp. References Mashimo T, Takizawa A, Kobayashi J, Kunihiro Y, Yoshimi K, Ishida S, Tanabe K, Yanagi A, Tachibana A, Hirose J, Yomoda J, Morimoto S, Kuramoto T, Voigt B, Watanabe T, Hiai H, Tateno C, Komatsu K, Serikawa T. Generation and characterization of severe combined immunodeficiency rats. Cell Rep. 2012 Sep 27;2(3):685-94. Additional strain information