Strain information
 NBRP Rat No: 0646  Strain name: F344-Prkdcem1Kyo  Commmon Name: SCID Rat Genome Database
Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan
Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino (c)
Inbred Generations  F3(March 2012)
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected
Origin This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene. Background strain: F344/Stm
Strain characteristics This strain shows severe combined immunodeficiency´╝łSCID´╝ë caused by a 46-bp deletion in the exon 1 of Prkdc gene.
Breeding Conditions maintained by breeding between homozygous rats
Genotyping Primers for Prkdc: CTTGCGGTGCTGGCTACTAC and TTCCCTCTTGTACTCTCATCCAA. wild: 309-bp, mutant: 263-bp.
References Mashimo T, Takizawa A, Kobayashi J, Kunihiro Y, Yoshimi K, Ishida S, Tanabe K, Yanagi A, Tachibana A, Hirose J, Yomoda J, Morimoto S, Kuramoto T, Voigt B, Watanabe T, Hiai H, Tateno C, Komatsu K, Serikawa T.
Generation and characterization of severe combined immunodeficiency rats.
Cell Rep. 2012 Sep 27;2(3):685-94.

Additional strain information