Strain information  NBRP Rat No: 0667  Strain name: DA-Tyrem2Kyo  Commmon Name: DA albino Rat Genome Database Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color  albino Inbred Generations  F0 Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected Tyrosinase Origin The strain having a Endonuclease-induced mutation in Tyr gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University. Strain characteristics This rats show albino phyenotype on the DA/Slc background. Breeding Conditions good breeding performance Genotyping PCR. wild: 260-bp, mutant: 231-bp. primers: TTGCATAAATTGGTTTTCACAGA, ATTTAAACATGAAAATATTACCTTCCA References Mashimo T, Kaneko T, Sakuma T, Kobayashi J, Kunihiro Y, Voigt B, Yamamoto T, Serikawa T. Efficient gene targeting by TAL effector nucleases coinjected with exonucleases in zygotes. Sci Rep. 2013;3:1253. doi: 10.1038/srep01253. Epub 2013 Feb 13. Additional strain information