| NBRP Rat No: 0667 |
Strain name: DA-Tyrem2Kyo |
Commmon Name: DA albino |
Rat Genome Database |
| Principal Investigator: |
Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan |
| Tel: 03-6409-2489 Fax: |
Email: mashimo@ims.u-tokyo.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
albino |
| Inbred Generations |
F0 |
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Tyrosinase |
| Origin |
The strain having a Endonuclease-induced mutation in Tyr gene was established by TAL effector nuclease obtained from Dr. Yamamoto at Hiroshima University.
|
| Strain characteristics |
This rats show albino phyenotype on the DA/Slc background.
|
| Breeding Conditions |
good breeding performance |
| Genotyping |
PCR. wild: 260-bp, mutant: 231-bp. primers: TTGCATAAATTGGTTTTCACAGA, ATTTAAACATGAAAATATTACCTTCCA |
| References |
Mashimo T, Kaneko T, Sakuma T, Kobayashi J, Kunihiro Y, Voigt B, Yamamoto T, Serikawa T.
Efficient gene targeting by TAL effector nucleases coinjected with exonucleases in zygotes.
Sci Rep. 2013;3:1253. doi: 10.1038/srep01253. Epub 2013 Feb 13. |
| Additional strain information |
|
|