NBRP Rat No: 0676 |
Strain name: TRM.W-Tg(RNB1-186G14)33Kyo |
Commmon Name: TRM Spata22 Tg Line33 |
Rat Genome Database |
Principal Investigator: |
Takashi Kuramoto Graduate School of Medicine, Kyoto University Yoshidakonoe-cho, Sakyo-ku 606-8501 Kyoto Japan |
Tel: 075-753-4494 Fax: 075-753-4409 |
Email: kuramot@anim.med.kyoto-u.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
albino |
Inbred Generations |
N3F5 |
Usage Restrictions |
|
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
|
Origin |
F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236 - 60354841 of Rat Chr 10. This region contains Spata22 gene expressed in testes. |
Strain characteristics |
TRM rat has a 200-bp deletion including Aspa and Spata22 gene, resulting in leukodystrophy (Aspa defect) and infertility (Spata22 defect). By introduction of RNB1-186G14, infertility phenotype was rescued. |
Breeding Conditions |
crossing between tm/tm homozygous rats |
Genotyping |
Primers pKS145-F:aacgtcgtgactgggaaaac, pKS145-R:cccagcttctgtatggaacg PCR (2xAmpdirect,BIO TAQ DNA polymerase): 94℃ 3 min, 40 cycles of 94℃ 30 sec, 55℃ 1 min, 72℃ 45 sec, 72℃ 3 min, 15℃ 30 min |
References |
|
Additional strain information |
|
|