| NBRP Rat No: 0676 |
Strain name: TRM.W-Tg(RNB1-186G14)33Kyo |
Commmon Name: TRM Spata22 Tg Line33 |
Rat Genome Database |
| Principal Investigator: |
Takashi Kuramoto Tokyo University of Agriculture 1737 Funako, Atsugi, 243-0034 Kanagawa Japan |
| Tel: 046-270-6583 Fax: 046-270-6585 |
Email: tk206782@nodai.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
albino |
| Inbred Generations |
N3F5 |
| Usage Restrictions |
|
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
|
| Origin |
F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236 - 60354841 of Rat Chr 10. This region contains Spata22 gene expressed in testes. |
| Strain characteristics |
TRM rat has a 200-bp deletion including Aspa and Spata22 gene, resulting in leukodystrophy (Aspa defect) and infertility (Spata22 defect). By introduction of RNB1-186G14, infertility phenotype was rescued. |
| Breeding Conditions |
crossing between tm/tm homozygous rats |
| Genotyping |
Primers pKS145-F:aacgtcgtgactgggaaaac, pKS145-R:cccagcttctgtatggaacg PCR (2xAmpdirect,BIO TAQ DNA polymerase): 94℃ 3 min, 40 cycles of 94℃ 30 sec, 55℃ 1 min, 72℃ 45 sec, 72℃ 3 min, 15℃ 30 min |
| References |
|
| Additional strain information |
|
|