Strain information
 NBRP Rat No: 0676  Strain name: TRM.W-Tg(RNB1-186G14)33Kyo  Commmon Name: TRM Spata22 Tg Line33 Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Tokyo University of Agriculture       1737 Funako, Atsugi,    243-0034 Kanagawa     Japan
Tel: 046-270-6583    Fax: 046-270-6585 Email: tk206782@nodai.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino
Inbred Generations  N3F5
Usage Restrictions  
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected
Origin F344/Stm rat BAC clone RNB1-186G14 was microinjected into embyos of Wistar rats. The founder rats were backcrossed to TRM rats. BAC vector:pKS145. RNB1-186G14 contains region between 60185236 - 60354841 of Rat Chr 10. This region contains Spata22 gene expressed in testes.
Strain characteristics TRM rat has a 200-bp deletion including Aspa and Spata22 gene, resulting in leukodystrophy (Aspa defect) and infertility (Spata22 defect). By introduction of RNB1-186G14, infertility phenotype was rescued.
Breeding Conditions crossing between tm/tm homozygous rats
Genotyping Primers pKS145-F:aacgtcgtgactgggaaaac, pKS145-R:cccagcttctgtatggaacg PCR (2xAmpdirect,BIO TAQ DNA polymerase): 94℃ 3 min, 40 cycles of 94℃ 30 sec, 55℃ 1 min, 72℃ 45 sec, 72℃ 3 min, 15℃ 30 min
References
Additional strain information