NBRP Rat No: 0696 |
Strain name: W-Il2rgtm1Hina |
Commmon Name: Wistar-X-SCID, W-Il2rgKO /Hina |
Rat Genome Database |
Principal Investigator: |
Hiromitsu Nakauchi The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai, Minato-ku, 108-8639 Tokyo Japan |
Tel: 03-5449-5331 Fax: 03-5449-5451 |
Email: nakauchi@ims.u-tokyo.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
アルビノ |
Inbred Generations |
|
Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
In publishing, a citation of the literature(s) designated by the DEPOSITOR is requested.
The recipient must agree not to publish any results until publication of the literature(s) designated by the DEPOSITOR.
In publishing of data resulting from the use of the BIOLOGICAL RESOURCE, DEPOSITOR requires the statement that the BIOLOGICAL RESOURCE belongs to JST ERATO, NAKAUCHI Stem Cell and Organ Regeneration. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Interleukin 2 receptor gamma (Il2rg) |
Origin |
This strain was generated by electroporation method: introduction of Il2rg gene-targeting vector (PGK promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat(Crlj:Wistar). |
Strain characteristics |
This strain shows severe combined immunodeficiency (SCID) caused by a 636-bp deletion between Exon7 and Intron8 in the Il2rg gene and knock-in of Neomycin registance gene.
This strain can grow normally under SPF condition. |
Breeding Conditions |
Maintained by mating of hemizygous male and heterozygous female. |
Genotyping |
PCR analysis.
wild: 620-bp, mutant: 330-bp.
primers: ATGCCTCGAATTCCCGCCA, TGCGAAGTGGACCTGGGA, GAGGTTAGCATCACTTAGGGCT
annealing temperature: 58℃
|
References |
unpublished |
Additional strain information |
|
|