Strain information
 NBRP Rat No: 0696  Strain name: W-Il2rgtm1Hina  Commmon Name: Wistar-X-SCID, W-Il2rgKO /Hina Rat Genome Database
Principal Investigator:  Hiromitsu Nakauchi  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai, Minato-ku,    108-8639 Tokyo     Japan
Tel: 03-5449-5331    Fax: 03-5449-5451 Email: nakauchi@ims.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  アルビノ
Inbred Generations  
Usage Restrictions   The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.

In publishing, a citation of the literature(s) designated by the DEPOSITOR is requested.

The recipient must agree not to publish any results until publication of the literature(s) designated by the DEPOSITOR.

In publishing of data resulting from the use of the BIOLOGICAL RESOURCE, DEPOSITOR requires the statement that the BIOLOGICAL RESOURCE belongs to JST ERATO, NAKAUCHI Stem Cell and Organ Regeneration.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Interleukin 2 receptor gamma (Il2rg)
Origin This strain was generated by electroporation method: introduction of Il2rg gene-targeting vector (PGK promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat（Crlj:Wistar).
Strain characteristics This strain shows severe combined immunodeficiency (SCID) caused by a 636-bp deletion between Exon7 and Intron8 in the Il2rg gene and knock-in of Neomycin registance gene. This strain can grow normally under SPF condition.
Breeding Conditions Maintained by mating of hemizygous male and heterozygous female.
Genotyping PCR analysis. wild: 620-bp, mutant: 330-bp. primers: ATGCCTCGAATTCCCGCCA, TGCGAAGTGGACCTGGGA, GAGGTTAGCATCACTTAGGGCT annealing temperature: 58℃
References unpublished
Additional strain information