NBRP Rat No: 0722 |
Strain name: SD-Pax6Sey2/Mce |
Commmon Name: |
Rat Genome Database |
Principal Investigator: |
Sachiko Iseki Tokyo Medical and Dental University 1-5-45, Yushima, Bunkyo-ku 113-8549 Japan |
Tel: 03-5803-5579 Fax: 03-5803-0213 |
Email: s.iseki.emb@tmd.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
白 |
Inbred Generations |
F15 |
Usage Restrictions |
The recipient is requested to cite the literature designated by the DEPOSITOR. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Pax6 |
Origin |
This rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.). |
Strain characteristics |
homozygous rats: embryonic lethality
heterozygous rats: microphthalmia |
Breeding Conditions |
Mating between heterozygous rats. heterozygous rats is identified by microphthalmia. |
Genotyping |
Pax6AS CTTGCGTGGGTTGCCCTGGTA
Pax6S GTGTCATCAATAAACAGAGTTCTTC
|
References |
Osumi N, Hirota A, Ohuchi H, Nakafuku M, Iimura T, Kuratani S, Fujiwara M, Noji S, Eto K.:Pax-6 is involved in the specification of hindbrain motor neuron subtype.Development.124(15):2961-2972,1997.
|
Additional strain information |
|
|