Strain information
 NBRP Rat No: 0722  Strain name: SD-Pax6Sey2/Mce  Commmon Name: Rat Genome Database
Principal Investigator:  Sachiko Iseki  Tokyo Medical and Dental University       1-5-45, Yushima, Bunkyo-ku    113-8549      Japan
Tel: 03-5803-5579    Fax: 03-5803-0213 Email: s.iseki.emb@tmd.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  F15
Usage Restrictions  The recipient is requested to cite the literature designated by the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Pax6
Origin This rat (developed spontaneous microphthalmia) was found in a SD rat colony at Yamanouchi Pharma Inc. (Astellas Pharma Inc.).
Strain characteristics homozygous rats: embryonic lethality heterozygous rats: microphthalmia
Breeding Conditions Mating between heterozygous rats. heterozygous rats is identified by microphthalmia.
Genotyping Pax6AS CTTGCGTGGGTTGCCCTGGTA Pax6S GTGTCATCAATAAACAGAGTTCTTC
References Osumi N, Hirota A, Ohuchi H, Nakafuku M, Iimura T, Kuratani S, Fujiwara M, Noji S, Eto K.:Pax-6 is involved in the specification of hindbrain motor neuron subtype.Development.124(15):2961-2972,1997.

Additional strain information