Strain information
 NBRP Rat No: 0782  Strain name: SHR-C3em1Kyo  Commmon Name: SHR-C3emKyoホモ, Rat Genome Database
Principal Investigator:  Noboru Fukuda  Nihon University Advanced Research Institute for the Sience and Humanities       12-5, Goban-cho, Chiyoda-ku    102-8251 Tokyo     Japan
Tel: 03-5275-7963    Fax: 03-3972-8666 Email: fukuda.noboru@nihon-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  F4
Usage Restrictions  In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested.
In publishing, an acknowledgment to the DEPOSITOR is requested
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected chr 9 complement 3
Origin Zinc-finger nucleases (ZFNs) method targeting rat C3 was used(Product No. CSTZFN-1KT, Target gene: complement 3, Lot No. 11161218MN).
Strain characteristics The body weight of this strain is lower than WKY/Izm andSHR/Izm. This strain shows lower blood pressure than SHR/Izm at 4-6 weeks (male rat).
Breeding Conditions SHR-C3emKyo homozygous rats are fertile. About 30% rats die after birth.
Genotyping Primer F ACTCTTCCCTGTCTTGCGTC, R AATAGAGGCCACCAATGCAC（product size 308bp） genomic PCR condition : 94℃　3min, 94℃　30sec, 60.0℃　1min, 72.0℃　45sec (35cycles), 72.0℃　3min 9bp deletion
References 1. Negishi E, Fukuda N, Otsuki T, Katakawa M, Komatsu K, Chen L, Tanaka S, Kobayashi H, Hatanaka Y, Ueno T, Endo M, Mashimo T, Nishiyama A, Abe M. Involvement of complement 3 in the salt-sensitive hypertension by activation of renal renin-angiotensin system in spontaneously hypertensive rats. American Journal of Physiology Renal Physiology. 315: F1747–F1758, 2018.

2. Chen L, Fukuda N, Otsuki T, Tanaka S, Nakamura Y, Kobayashi H, Matsumoto T, Abe M. Increased complement 3 with suppression of miR-145 induces the synthetic phenotype in vascular smooth muscle cells from spontaneously hypertensive rats. Journal of American Heart Association. 8(10):e012327, 2019.

3. Chen L, Fukuda N, Shimizu S, Kobayashi H, Tanaka S, Nakamura Y, Matsumoto T, Abe M. Role of complement 3 in renin generation during the differentiation of mesenchymal stem cells to smooth muscle cells. American Journal of Physiology Cell Physiology. 318: C981-C990, 2020.
Additional strain information