NBRP Rat No: 0782 |
Strain name: SHR-C3em1Kyo |
Commmon Name: SHR-C3emKyoホモ, |
Rat Genome Database |
Principal Investigator: |
Noboru Fukuda Nihon University Advanced Research Institute for the Sience and Humanities 12-5, Goban-cho, Chiyoda-ku 102-8251 Tokyo Japan |
Tel: 03-5275-7963 Fax: 03-3972-8666 |
Email: fukuda.noboru@nihon-u.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
白 |
Inbred Generations |
F4 |
Usage Restrictions |
In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested. In publishing, an acknowledgment to the DEPOSITOR is requested |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
chr 9 complement 3 |
Origin |
Zinc-finger nucleases (ZFNs) method targeting rat C3 was used(Product No. CSTZFN-1KT, Target gene: complement 3, Lot No. 11161218MN). |
Strain characteristics |
The body weight of this strain is lower than WKY/Izm andSHR/Izm. This strain shows lower blood pressure than SHR/Izm at 4-6 weeks (male rat). |
Breeding Conditions |
SHR-C3emKyo homozygous rats are fertile. About 30% rats die after birth. |
Genotyping |
Primer F ACTCTTCCCTGTCTTGCGTC, R AATAGAGGCCACCAATGCAC(product size 308bp)
genomic PCR condition : 94℃ 3min, 94℃ 30sec, 60.0℃ 1min, 72.0℃ 45sec (35cycles), 72.0℃ 3min
9bp deletion
|
References |
1. Negishi E, Fukuda N, Otsuki T, Katakawa M, Komatsu K, Chen L, Tanaka S, Kobayashi H, Hatanaka Y, Ueno T, Endo M, Mashimo T, Nishiyama A, Abe M. Involvement of complement 3 in the salt-sensitive hypertension by activation of renal renin-angiotensin system in spontaneously hypertensive rats. American Journal of Physiology Renal Physiology. 315: F1747–F1758, 2018.
2. Chen L, Fukuda N, Otsuki T, Tanaka S, Nakamura Y, Kobayashi H, Matsumoto T, Abe M. Increased complement 3 with suppression of miR-145 induces the synthetic phenotype in vascular smooth muscle cells from spontaneously hypertensive rats. Journal of American Heart Association. 8(10):e012327, 2019.
3. Chen L, Fukuda N, Shimizu S, Kobayashi H, Tanaka S, Nakamura Y, Matsumoto T, Abe M. Role of complement 3 in renin generation during the differentiation of mesenchymal stem cells to smooth muscle cells. American Journal of Physiology Cell Physiology. 318: C981-C990, 2020. |
Additional strain information |
|
|
|