Strain information

Back to the list 640 / 882

NBRP Rat No: 0737

Strain name: SER.TRMR.W-Tg(RNB1-186G14)51Kyo

Commmon Name: SER-Tg(Spata22)

Rat Genome Database

Principal Investigator:

Takashi KuramotoTokyo University of Agriculture

Preservation Status:

Embryo Sperm Living Animals

Coat Color

albino

Inbred Generations

N3F4

Usage Restrictions

The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.

Genetic Status

Inbred Segregating Congenic Consomic Recombinant Coisogenic Spont. Mutant Transgene Ind. Mutant Category Other

Comercial Availability

Research Category

Diabetes Obesity Neurobiology Ophthalmology Dentistry Cardio Hypertension Cancer Metabolism Otorhinology Immunology Infectious Osteosis Internal Organ Dermatology Reproduction Development Behavior Hematology Urology Pharmacology Research Area Others

Control Strain Marker Strain

Gene Affected

Origin

The sperms from N2 generation rat (ID#252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) were microinjected into SER embyos. The offspring with transgese was backcrossed with SER rats.

Strain characteristics

SER (spontaneously epileptic rat): double mutant of tremor and zitter mutation (tm/tm, zi/zi) and SER homozygous rats are infertility. TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) (tm/tm, Tg+) and SER heterozygous (tm/+, zi/zi) rats were crossed and F1 rats were obtained. These rats were backcrossed with SER heterozygous rats and SER homozygous/Tg; rats were obtained. This rat (tm/tm, zi/zi, Tg+）shows tremors and tonic-clonic seizure, and dies around 3 months old.

Breeding Conditions

crossing between tm/+ rats.

Genotyping

Primers: pKS145-F:aacgtcgtgactgggaaaac, pKS145-R:cccagcttctgtatggaacg Reaction reagent: 2ｘAmpdirect,BIO TAQ DNA polymerase, Control: posi:RNB1-186G14,nega:TRMR(tm/tm) PCR condition: 94℃, 3 min, 40 cycles of 94℃, 30 sec, 55℃, 1 min, 72℃, 45 sec, and 72℃, 3 min, 15℃, 30 min

References

Additional strain information (Japanese only)