| NBRP Rat No: 0737 |
Strain name: SER.TRMR.W-Tg(RNB1-186G14)51Kyo |
Commmon Name: SER-Tg(Spata22) |
Rat Genome Database |
| Principal Investigator: |
Takashi Kuramoto Tokyo University of Agriculture 1737 Funako, Atsugi, 243-0034 Kanagawa Japan |
| Tel: 046-270-6583 Fax: 046-270-6585 |
Email: tk206782@nodai.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
albino |
| Inbred Generations |
N3F4 |
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
|
| Origin |
The sperms from N2 generation rat (ID#252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) were microinjected into SER embyos. The offspring with transgese was backcrossed with SER rats. |
| Strain characteristics |
SER (spontaneously epileptic rat): double mutant of tremor and zitter mutation (tm/tm, zi/zi) and SER homozygous rats are infertility. TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) (tm/tm, Tg+) and SER heterozygous (tm/+, zi/zi) rats were crossed and F1 rats were obtained. These rats were backcrossed with SER heterozygous rats and SER homozygous/Tg; rats were obtained. This rat (tm/tm, zi/zi, Tg+）shows tremors and tonic-clonic seizure, and dies around 3 months old. |
| Breeding Conditions |
crossing between tm/+ rats. |
| Genotyping |
Primers: pKS145-F:aacgtcgtgactgggaaaac, pKS145-R:cccagcttctgtatggaacg
Reaction reagent: 2ｘAmpdirect,BIO TAQ DNA polymerase,
Control: posi:RNB1-186G14,nega:TRMR(tm/tm)
PCR condition: 94℃, 3 min, 40 cycles of 94℃, 30 sec, 55℃, 1 min, 72℃, 45 sec, and 72℃, 3 min, 15℃, 30 min
|
| References |
|
| Additional strain information |
|
|