Strain information
 NBRP Rat No: 0737  Strain name: SER.TRMR.W-Tg(RNB1-186G14)51Kyo  Commmon Name: SER-Tg(Spata22) Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Tokyo University of Agriculture       1737 Funako, Atsugi,    243-0034 Kanagawa     Japan
Tel: 046-270-6583    Fax: 046-270-6585 Email: tk206782@nodai.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino
Inbred Generations  N3F4
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected
Origin The sperms from N2 generation rat (ID#252) of TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) were microinjected into SER embyos. The offspring with transgese was backcrossed with SER rats.
Strain characteristics SER (spontaneously epileptic rat): double mutant of tremor and zitter mutation (tm/tm, zi/zi) and SER homozygous rats are infertility. TRMR.W-Tg(RNB1-186G14)51Kyo (NBRP-Rat#0677) (tm/tm, Tg+) and SER heterozygous (tm/+, zi/zi) rats were crossed and F1 rats were obtained. These rats were backcrossed with SER heterozygous rats and SER homozygous/Tg; rats were obtained. This rat (tm/tm, zi/zi, Tg+)shows tremors and tonic-clonic seizure, and dies around 3 months old.
Breeding Conditions crossing between tm/+ rats.
Genotyping Primers: pKS145-F:aacgtcgtgactgggaaaac, pKS145-R:cccagcttctgtatggaacg Reaction reagent: 2xAmpdirect,BIO TAQ DNA polymerase, Control: posi:RNB1-186G14,nega:TRMR(tm/tm) PCR condition: 94℃, 3 min, 40 cycles of 94℃, 30 sec, 55℃, 1 min, 72℃, 45 sec, and 72℃, 3 min, 15℃, 30 min
References
Additional strain information