Strain information
 NBRP Rat No: 0739  Strain name: F344-Depdc5em2kyo  Commmon Name: F344-Depdc5em2Kyo/Kyo Rat Genome Database
Principal Investigator:  Stephanie BAULAC  ICM - Institut du Cerveau et de la Moelle épinière       Hôpital Pitié-Salpêtrière 47 bd de l'Hôpital    75013 Paris     France
Tel: +33 (0)1-5727-4339    Fax: +33 (0)1-5727-4339 Email: stephanie.baulac@upmc.fr
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino
Inbred Generations  G2 (BCP2)
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Depdc5: DEP domain containing 5
Origin This rat was created by the transcription activator-like effector nuclease (TALEN) technology. A pair of TALENs targeting exon 2 of rat Depdc5 (Ensembl: ENSRNOT00000085788) were microinjected into fertilized eggs of F344, and then transferred into the oviducts of pseudopregnant Wistar female rats, as previously described (Mashimo et al., 2013). TAL Effector Nucleotide Targeter 2.0 (https://tale-nt.cac.cornell.edu/) did not predict off-target site.
Strain characteristics Homozygous Depdc5−/− embryos died from embryonic day 14.5 due to a global growth delay. Heterozygous Depdc5+/− rats developed normally and exhibited no spontaneous electroclinical seizures, but had altered cortical neuron excitability and firing patterns. Depdc5+/− rats displayed cortical cytomegalic dysmorphic neurons and balloon-like cells strongly expressing phosphorylated rpS6, indicative of mTORC1 upregulation, and not observed after prenatal rapamycin treatment.
Breeding Conditions Homozygous Depdc5−/− rats are lethal, but heterozygous Depdc5+/− rats are fertile.
Genotyping Primer (5'-3') Forward AGCCTGACATTCTCGCTGTT Reverse TCTTGCCCCACTCATTTACC (product size 267bp) Mutation c.39_55delinsT (p.Lys13Asnfs*8) (NM_001107229.1)
References Marsan E, Ishida S, Schramm A, Weckhuysen S, Muraca G, Lecas S, Liang N, Treins C, Pende M, Roussel D, Le Van Quyen M, Mashimo T, Kaneko T, Yamamoto T, Sakuma T, Mahon S, Miles R, Leguern E, Charpier S, Baulac S.
Depdc5 knockout rat: A novel model of mTORopathy.
Neurobiol Dis. 2016 Feb 9. pii: S0969-9961(16)30031-6.
Additional strain information