NBRP Rat No: 0739 |
Strain name: F344-Depdc5em2kyo |
Commmon Name: F344-Depdc5em2Kyo/Kyo |
Rat Genome Database |
Principal Investigator: |
Stephanie BAULAC ICM - Institut du Cerveau et de la Moelle épinière Hôpital Pitié-Salpêtrière 47 bd de l'Hôpital 75013 Paris France |
Tel: +33 (0)1-5727-4339 Fax: +33 (0)1-5727-4339 |
Email: stephanie.baulac@upmc.fr |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
albino |
Inbred Generations |
G2 (BCP2) |
Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Depdc5: DEP domain containing 5 |
Origin |
This rat was created by the transcription activator-like effector nuclease (TALEN) technology. A pair of TALENs targeting exon 2 of rat Depdc5 (Ensembl: ENSRNOT00000085788) were microinjected into fertilized eggs of F344, and then transferred into the oviducts of pseudopregnant Wistar female rats, as previously described (Mashimo et al., 2013). TAL Effector Nucleotide Targeter 2.0 (https://tale-nt.cac.cornell.edu/) did not predict off-target site. |
Strain characteristics |
Homozygous Depdc5−/− embryos died from embryonic day 14.5 due to a global growth delay.
Heterozygous Depdc5+/− rats developed normally and exhibited no spontaneous electroclinical seizures, but had altered cortical neuron excitability and firing patterns. Depdc5+/− rats displayed cortical cytomegalic dysmorphic neurons and balloon-like cells strongly expressing phosphorylated rpS6, indicative of mTORC1 upregulation, and not observed after prenatal rapamycin treatment.
|
Breeding Conditions |
Homozygous Depdc5−/− rats are lethal, but heterozygous Depdc5+/− rats are fertile. |
Genotyping |
Primer (5'-3')
Forward AGCCTGACATTCTCGCTGTT
Reverse TCTTGCCCCACTCATTTACC
(product size 267bp)
Mutation c.39_55delinsT (p.Lys13Asnfs*8) (NM_001107229.1) |
References |
Marsan E, Ishida S, Schramm A, Weckhuysen S, Muraca G, Lecas S, Liang N, Treins C, Pende M, Roussel D, Le Van Quyen M, Mashimo T, Kaneko T, Yamamoto T, Sakuma T, Mahon S, Miles R, Leguern E, Charpier S, Baulac S.
Depdc5 knockout rat: A novel model of mTORopathy.
Neurobiol Dis. 2016 Feb 9. pii: S0969-9961(16)30031-6. |
Additional strain information |
|
|