Strain information
 NBRP Rat No: 0753  Strain name: F344-Zeb2em1Kyo  Commmon Name: Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Graduate School of Medicine, Kyoto University       Yoshidakonoe-cho, Sakyo-ku    606-8501 Kyoto     Japan
Tel: 075-753-4494    Fax: 075-753-4409 Email: kuramot@anim.med.kyoto-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/Zeb2_KO/Zeb2_1024.jpg ../images/Photos/Zeb2_KO/Zeb2_organ_1024.jpg
Coat Color  albino
Inbred Generations  
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Zeb2: zinc finger E-box binding homeobox 2
Origin Zinc-finger nucleases (ZFNs) method taregting exon 5 of Zeb2 gene (AGCCAAAGCTTGCCTCCA and GACTACTGACTCAAG) was used; This strain has a 5-bp deletion (cagag) and a 2-bp insertion (tc) in exon7 of Zeb2 gene, resulting in a deletion of Glutamine(Q)541. background strain: F344/Stm
Strain characteristics No abnormalities in gross appearance and behavior. Good breeding performance
Breeding Conditions sib mating between homozygous rats. Good breeding performance.
Genotyping Zeb2_Small-F: CTCAGCCAGAAGAACAAGGG Zeb2_Small-R: CACAGGTAGCGTTCATGCTG Annealing temparature: 60℃
References
Additional strain information