Strain information  NBRP Rat No: 0778  Strain name: W-Tg(HCRT-cre,-EGFP)B5Ahky  Commmon Name: orexin-Cre rat Rat Genome Database Principal Investigator:  Akihiro Yamanaka  Nagoya University       Furo-cho, Chikusa-ku    464-8601 Nagoya      Japan Tel: 052-789-3864    Fax: 052-789-3889 Email: yamank@riem.nagoya-u.ac.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color   Inbred Generations   Usage Restrictions  The RECIPIENT should inform DEPOSITOR about research project in advance. DEPOSITOR should be included as co-authors (at least in the first article). Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected HCRT: hypocretin (orexin) neuropeptide precursor , EGFP: Enhanced Green Fluorescent Protein Origin This transgenic rat strain was established by Dr. Yamanaka (Nagoya University) in 2012. Background strain: Wistar rat (CLEA Japan). plasmid backbone: pCR2.1. Transgene: human HCRT gene promoter, cre recombinase, EGFP gene, 2A gene Strain characteristics EGFP and cre recombinase are specifically expressed in orexin neurons. Breeding Conditions Genotyping Genotyping by PCR. Primers for EGFP: EGFP5 CACAAGTTCAGCGTGTCCG, EGFP32 TCAGCTCGATGCGGTTCAC or primers for hOX-promoter: hoxpro-AS AAGTCGACGGTGTCTGGCGCTCAGGGTG, hoxpro-S GCAGCGGCCATTCCTTGG References Dergacheva O, Yamanaka A, Schwartz AR, Polotsky VY, Mendelowitz D. Hypoxia and hypercapnia inhibit hypothalamic orexin neurons in rats. J Neurophysiol. 2016 Nov 1;116(5):2250-2259. doi: 10.1152/jn.00196.2016. Epub 2016 Additional strain information