| NBRP Rat No: 0777 |
Strain name: DWH/Iet |
Commmon Name: DWH,Dwarfism derived from Wistar Hannover GALAS rats |
Rat Genome Database |
| Principal Investigator: |
Akira Sato The Institute of Environmental Toxicology 303-0043 Japan |
| Tel: 0297-27-4537 Fax: 0297-27-4519 |
Email: a.satoh@iet.or.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
アルビノ |
| Inbred Generations |
F27 (2014.9.12) |
| Usage Restrictions |
In publishing, the references designated by the DEPOSITOR are requested to be cited. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Tg: thyroglobulin |
| Origin |
In 2003, 2 dwarf pups (same litter) were found in a colony of Wistar Hannover GALAS (BrlHan:WIST@Jcl [GALAS]) rats (Japan CLEA). A dwarf male rat and normal female were mated (sib mating) as founder, and sib mating was performed afterward. |
| Strain characteristics |
Spontaneous mutation (Tgc.749?1G>T) in the exon6 of Thyroglobulin gene causes abnormality in thyroid gland hormone synthesis. Homozygous rats show dwarfism from 2-week-old by thyroid gland hormone deficiency and goitar. Heterozygous rats develop goitar only. Histopatologically, vacuolar change in the folicullar epithelial cells is observed. |
| Breeding Conditions |
Sib mating (heterozygous condition). Average litter size (F20～25): 8 pups |
| Genotyping |
Allele specific PCR (product size: 170 bps)
Reverse primers: cggaatctgccagagatgac (wild type), ccctgaaatgctatctacatttgtttct (Mutant) and Reverse primer: cggaatctgccagagatgac.
PCR reaction: Denature (94℃, 10 min), 30 cycles of 94℃/30 sec, 55℃/30 sec, 72℃/30 sec). |
| References |
Sato A, Abe K, Yuzuriha M, Fujii S, Takahashi N, Hojo H, Teramoto S, Aoyama H.
A novel mutation in the thyroglobulin gene that causes goiter and dwarfism in Wistar Hannover GALAS rats.
Mutat Res Fundam Mol Mech Mutagen. 762:17-23, 2014. |
| Additional strain information |
|
|