Strain information
 NBRP Rat No: 0764  Strain name: F344-Ppargm1Kyo  Commmon Name: Rat Genome Database
Principal Investigator:  Kazuwa　Nakao  Kyoto University Graduate School of Medicine        53 Shogoin-Kawahara-chou, Sakyo-ku    606-8507 Kyoto city     Japan
Tel: 075-366-7450    Fax: 075-752-7140 Email: nakao@kuhp.kyoto-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  N6
Usage Restrictions  The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from DEPOSITOR. The RECIPIENT must agree on collaborative research with the DIPOSITOR. Any form of publication data resulting from the use of the BIOLOGICAL RESOURCE require co-authorship. This condition is NOT limited to two-year period after deposition.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Pparg
Origin By using ENU mutagenesis followed by MuT-POWER screening of the KURMA （Kyoto University Rat Mutant Archive) samples, the depositors generated a heterozygous PPARg mutant (Ppargmkyo/+) rat with a missense mutation (G488T (C163F)) in Pparg.
Strain characteristics PpargG488T homozygous rats are embryonic lethal. Heterozygous Ppargmkyo/+ rats showed reduced fat mass with adipocyte hypertrophy and insulin resistance, which were highly predictable from known actions of PPARγ agonists and phenotypes of patients with the PPARγ mutation.
Breeding Conditions mating between PpargG488T　heterozygous male rat and wild-type female rat.
Genotyping PpargG488T can be identified by real-time PCR sysytem using genomicDNA from blood samples. Primers are Forward: CTGTCGGATCCACAAAAAGAGTAGA and Reverse: CCCCACAGCAAGGCACTT. TaqMan MGB probes are WT probe: CTGAAACCGACAGTACTG and mutant probe: CTGAAACCGAAAGTACTG. PCR condition: 95C 20 sec, 40 cycles of 95C 3 sec and 60C 20 sec.
References Gumbilai V, Ebihara K, Aizawa-Abe M, Ebihara C, Zhao M, Yamamoto Y, Mashimo T, Hosoda K, Serikawa T, Nakao K.
Fat Mass Reduction With Adipocyte Hypertrophy and Insulin Resistance in Heterozygous PPARγ Mutant Rats.
Diabetes. 2016 Oct;65(10):2954-2965.
Additional strain information