| NBRP Rat No: 0764 |
Strain name: F344-Ppargm1Kyo |
Commmon Name: |
Rat Genome Database |
| Principal Investigator: |
Kazuwa Nakao Kyoto University Graduate School of Medicine 53 Shogoin-Kawahara-chou, Sakyo-ku 606-8507 Kyoto city Japan |
| Tel: 075-366-7450 Fax: 075-752-7140 |
Email: nakao@kuhp.kyoto-u.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白 |
| Inbred Generations |
N6 |
| Usage Restrictions |
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from DEPOSITOR. The RECIPIENT must agree on collaborative research with the DIPOSITOR. Any form of publication data resulting from the use of the BIOLOGICAL RESOURCE require co-authorship. This condition is NOT limited to two-year period after deposition. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Pparg |
| Origin |
By using ENU mutagenesis followed by MuT-POWER screening of the KURMA (Kyoto University Rat Mutant Archive) samples, the depositors generated a heterozygous PPARg mutant (Ppargmkyo/+) rat with a missense mutation (G488T (C163F)) in Pparg. |
| Strain characteristics |
PpargG488T homozygous rats are embryonic lethal. Heterozygous Ppargmkyo/+ rats showed reduced fat mass with adipocyte hypertrophy and insulin resistance, which were highly predictable from known actions of PPARγ agonists and phenotypes of patients with the PPARγ mutation. |
| Breeding Conditions |
mating between PpargG488T heterozygous male rat and wild-type female rat. |
| Genotyping |
PpargG488T can be identified by real-time PCR sysytem using genomicDNA from blood samples. Primers are Forward: CTGTCGGATCCACAAAAAGAGTAGA and Reverse: CCCCACAGCAAGGCACTT. TaqMan MGB probes are WT probe: CTGAAACCGACAGTACTG and
mutant probe: CTGAAACCGAAAGTACTG. PCR condition: 95C 20 sec, 40 cycles of 95C 3 sec and 60C 20 sec. |
| References |
Gumbilai V, Ebihara K, Aizawa-Abe M, Ebihara C, Zhao M, Yamamoto Y, Mashimo T, Hosoda K, Serikawa T, Nakao K.
Fat Mass Reduction With Adipocyte Hypertrophy and Insulin Resistance in Heterozygous PPARγ Mutant Rats.
Diabetes. 2016 Oct;65(10):2954-2965. |
| Additional strain information |
|
|