Strain information
 NBRP Rat No: 0769  Strain name: F344-AsipA TyrC KitH/Kyo  Commmon Name: Agouti Fischer Rat Genome Database
Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan
Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  
Inbred Generations  
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected
Origin 1) point mutation in the exon 2 of Tyrosinase (Tyr) gene (albino phenotype), 2) 19-bp deletion in Asip gene (Agouti phenotype), and 3) retrotransposon insertion (7-bp) in kit gene (hooded phenotype) were targeted by CRISPR/Cas9 system using ssODN. The rat coat colour phenotype was changed from white to Agouti. Background strain: F344/Stm
Strain characteristics Agouti coat colour (genetic background: F344/Stm)
Breeding Conditions homozygous condition (wild-type color: Agouti)
Genotyping Tyr gene can be distinguished by sequence analysis (primers:TTGCATAAATTGGTTTTCACAGA and ATTTAAACATGAAAATATTACCTTCCA) Asip gene can be distinguished by PCR and AGE analysis (primers:ATGTCACCCGCTTACTCCTG and ACACTGCCAAGGACGCTATT) Kit gene can be distinguished by PCR and AGE analysis (primers:ACTCCAGGCCACAGACAACT and TGAAGAAAATTAGCATACCCGTCT)
References Yoshimi K, Kaneko T, Voigt B, Mashimo T.
Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform.
Nat Commun. 2014 Jun 26;5:4240.
Additional strain information