NBRP Rat No: 0783 |
Strain name: F344-Nfe2l2em1Kyo |
Commmon Name: Nrf2Δ7 |
Rat Genome Database |
Principal Investigator: |
Masayuki Yamamoto Tohoku University 2-1, Seiryo-machi, Aoba-ku, Sendai 980-8575 Miyagi Japan |
Tel: 022-717-8085 Fax: 022-717-8090 |
Email: masayuki.yamamoto.c7@tohoku.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
白 |
Inbred Generations |
|
Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. The recipient must obey regulations stipulated in the liscence agreement of Sigma-Aldrich Co. LLC. In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested: Generation of a New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B 1 Toxicity. Taguchi K et al. Toxicol Sci (2016) 152 (1): 40-52. A cooperative research is required for 2 years after depositing (DEPOSITOR should be included as co-authors). In case of patent application based on research using this resource, a discussion with DEPOSITOR is needed. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Nfe2l2:nuclear factor, erythroid 2-like 2 |
Origin |
Zinc-finger nucleases (ZFNs) method taregting exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 7-bp deletion in Nrf2 gene. Background strain: F344/Stm |
Strain characteristics |
Expression level of target gene of Nrf2 was decrerased by a deletion of Nrf2 transcription factor. |
Breeding Conditions |
mating between heterozygous male and heterozygous female |
Genotyping |
Sequencing
Nrf2 Small F TGAAAATGGGAGTTATCGGG
Nrf2 Small R TGTGTTCAAGGTGGGATTTG
|
References |
Taguchi K, Takaku M, Egner PA, Morita M, Kaneko T, Mashimo T, Kensler TW, Yamamoto M.
Generation of A New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B1 Toxicity.
Toxicol Sci. 2016 Jul;152(1):40-52. |
Additional strain information |
|
|