Strain information
 NBRP Rat No: 0770  Strain name: W-Rosa26em1(CAG-EGFP)Kyo  Commmon Name: Rosa EGFP knockin Rat Genome Database
Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan
Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ../images/Photos/ ../images/Photos/
Coat Color  
Inbred Generations  
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected
Origin CAG-GFP vector was knock-in into the rat Rosa26 locus by CRISPR/Cas9 system. Background strain: Crlj:WI
Strain characteristics Strong and stable systemic EGFP expression under CAG-promoter in the rat Rosa26 locus
Breeding Conditions maintained in EGFP-homozygous condition
Genotyping primers: rRosa26_Small_F : AAGGGAGCTGCAGTGGAGTA and rRosa26_Small_R : CCCAGGTGAGTGCCTAGTCT (360-bp) GFP expression is checked by phenotype. GFP_Small_F : CTACCCCGACCACATGAAG and GFP_Small_R : CTTGTGCCCCAGGATGTT "
References Yoshimi K, Kunihiro Y, Kaneko T, Nagahora H, Voigt B, Mashimo T.
ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes.
Nat Commun. 2016 Jan 20;7:10431
Additional strain information