Strain information
 NBRP Rat No: 0784  Strain name: F344-Nfe2l2em2Kyo  Commmon Name: Nrf2 +1 Rat Genome Database
Principal Investigator:  Masayuki Yamamoto  Tohoku University       2-1, Seiryo-machi, Aoba-ku, Sendai     980-8575 Miyagi     Japan
Tel: 022-717-8085    Fax: 022-717-8090 Email: masayuki.yamamoto.c7@tohoku.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  
Inbred Generations  
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The recipient must obey regulations stipulated in the liscence agreement of Sigma-Aldrich Co. LLC.
In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested: Generation of a New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B 1 Toxicity. Taguchi K et al. Toxicol Sci (2016) 152 (1): 40-52.
A cooperative research is required for 2 years after depositing (DEPOSITOR should be included as co-authors).
In case of patent application based on research using this resource, a discussion with DEPOSITOR is needed.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Nfe2l2：nuclear factor, erythroid 2-like 2
Origin Zinc-finger nucleases (ZFNs) method taregting exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 1 bp insertion in Nrf2 gene. Background strain: F344/Stm
Strain characteristics Expression level of target gene of Nrf2 was decrerased by a deletion of Nrf2 transcription factor.
Breeding Conditions mating between heterozygous male and heterozygous female
Genotyping Primers: Nrf2 Small F 　TGAAAATGGGAGTTATCGGG, Nrf2 Small R TGTGTTCAAGGTGGGATTTG Obtained PCR products (335 bp) is digested with BmgT120 I and two bands (184 bp and 151 bp) are detected in the mutated rats.
References Taguchi K, Takaku M, Egner PA, Morita M, Kaneko T, Mashimo T, Kensler TW, Yamamoto M.
Generation of A New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B1 Toxicity.
Toxicol Sci. 2016 Jul;152(1):40-52.
Additional strain information