| NBRP Rat No: 0784 |
Strain name: F344-Nfe2l2em2Kyo |
Commmon Name: Nrf2 +1 |
Rat Genome Database |
| Principal Investigator: |
Masayuki Yamamoto Tohoku University 2-1, Seiryo-machi, Aoba-ku, Sendai 980-8575 Miyagi Japan |
| Tel: 022-717-8085 Fax: 022-717-8090 |
Email: masayuki.yamamoto.c7@tohoku.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
|
| Inbred Generations |
|
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. The recipient must obey regulations stipulated in the liscence agreement of Sigma-Aldrich Co. LLC. In publishing, a citation of the following literature(s) designated by the DEPOSITOR is requested: Generation of a New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B 1 Toxicity. Taguchi K et al. Toxicol Sci (2016) 152 (1): 40-52. A cooperative research is required for 2 years after depositing (DEPOSITOR should be included as co-authors). In case of patent application based on research using this resource, a discussion with DEPOSITOR is needed. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Nfe2l2:nuclear factor, erythroid 2-like 2 |
| Origin |
Zinc-finger nucleases (ZFNs) method taregting exon 5 of Nrf2 (ACCACTGTCCCCAGCCCAgaggccACACTGACAGAGATGGAC) was used; This strain has a 1 bp insertion in Nrf2 gene. Background strain: F344/Stm |
| Strain characteristics |
Expression level of target gene of Nrf2 was decrerased by a deletion of Nrf2 transcription factor. |
| Breeding Conditions |
mating between heterozygous male and heterozygous female |
| Genotyping |
Primers: Nrf2 Small F TGAAAATGGGAGTTATCGGG, Nrf2 Small R TGTGTTCAAGGTGGGATTTG
Obtained PCR products (335 bp) is digested with BmgT120 I and two bands (184 bp and 151 bp) are detected in the mutated rats. |
| References |
Hamada N, Ito Y, Niimi H, Atarashi M, Kuwamura M, Taguchi K, Yamamoto M, Izawa T.
Nrf2 contributes to the protective effect of iron overload on thioacetamide-induced chronic liver injury in rats.
Toxicol Sci. 2025 Dec 4:kfaf165. doi: 10.1093/toxsci/kfaf165.
Taguchi K, Takaku M, Egner PA, Morita M, Kaneko T, Mashimo T, Kensler TW, Yamamoto M.
Generation of A New Model Rat: Nrf2 Knockout Rats Are Sensitive to Aflatoxin B1 Toxicity.
Toxicol Sci. 2016 Jul;152(1):40-52. |
| Additional strain information |
|
|