Strain information
 NBRP Rat No: 0806  Strain name: F344-Aspaem34Kyo  Commmon Name: Aspa KO (Line #34) Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Tokyo University of Agriculture       1737 Funako, Atsugi,    243-0034 Kanagawa     Japan
Tel: 046-270-6583    Fax: 046-270-6585 Email: tk206782@nodai.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino
Inbred Generations  
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other gene-modified rat
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Aspartoacylase
Origin TALEN (Left:TCGAGCATCCTTCCCTC, Right:CGTTCCATTGCCAAGTA）targeting the exon4 of Aspartoacylase (Aspa) gene was designed and mRNA coding TALEN was microinjected into F344/NSlc embyo.
Strain characteristics 16-bp deletion in the exon4 of Aspa gene: as a rexult of frameshift mutation, stop codon is produced. decreased expression levels of Aspa gene and ASPA protein. Histopatologically, this strain shows vacuole formation in the brain and spinal cord.
Breeding Conditions maintained by crossing between homozygous rats
Genotyping rAspa-e3-KO-F：aagaaagatgttttcaattttgttca rAspa-e3-KO-R：tctactgtgccagcaggaag PRODUCT SIZE：wild 151 bp, KO 135 bp
References Takeda S, Hoshiai R, Tanaka M, Izawa T, Yamate J, Kuramoto T, Kuwamura M.
Myelin lesion in the aspartoacylase (Aspa) knockout rat, an animal model for Canavan disease.
Exp Anim. 2024 Jul 9;73(3):347-356.

Nishitani A, Nagayoshi H, Takenaka S, Asano M, Shimizu S, Ohno Y, Kuramoto T.
Involvement of NMDA receptors in tremor expression in Aspa/Hcn1 double-knockout rats.
Exp Anim. 2020 Nov 12;69(4):388-394.

Nishitani A, Tanaka M, Shimizu S, Kunisawa N, Yokoe M, Yoshida Y, Suzuki T, Sakuma T, Yamamoto T, Kuwamura M, Takenaka S, Ohono Y, Kuramoto T.
Involvement of aspartoacylase in tremor expression in rats.
Exp Anim. 2016; 65(3): 293-301.
Additional strain information