Usage Restrictions
Users should be required an approval form from dipositor for 5 years after deposition.
Gene Affected
endothelin receptor type B: Ednrb
Origin
This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. This congenic strain was established by backcrossing (over 10 generations) of AR rat to F344/Nslc.
Strain characteristics
Homozygous rats shows auditory disorder (congenital deafness). 40% of homozygous rats dies of megacolon and this mortality is lower than that of AGH rats (100%). Heterozygous (sl/+) rats don't show any phenotypes.
Breeding Conditions
maintained in heterozygous condition: A part of homozygous rats dies of megacolon.
Genotyping
Forward Primer: CCTCCTGGACTAGAGGTTCC, Reverse Primer: ACGACTTAGAAAGCTACACT
Product size wild-type：511 bp, mutant：210 bp
References
Dang et al. QTL analysis identifies a modifier locus of aganglionosis in the rat model of Hirschsprung disease carrying Ednrb(sl) mutations. PLoS ONE (2011) vol. 6 (11) pp. e27902
Dang et al. Genetic background strongly modifies the severity of symptoms of Hirschsprung disease, but not hearing loss in rats carrying Ednrb(sl) mutations. PLoS ONE (2011) vol. 6 (9) pp. e24086
Dang et al. Lymphopenia in Ednrb-deficient rat was strongly modified by genetic background. Biomed Res (2012) vol. 33 (4) pp. 249-53