Strain information
 NBRP Rat No: 0802  Strain name: LEH/Hkv  Commmon Name: LEH-Ednrbsl, LEH.AR-Ednrbsl/Hkv Rat Genome Database
Principal Investigator:  Takashi Agui  Graduate School of Veterinary Medicine       Nishi 9 Kita 18 jou Kita-ku, Sapporo    060-0818 Hokkaido     Japan
Tel: 011-706-5106     Fax: 011-706-5106 Email: agui@vetmed.hokudai.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白黒、頭巾班
Inbred Generations  F21+?
Usage Restrictions  Users should be required an approval form from dipositor for 5 years after deposition.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected endothelin receptor type B: Ednrb
Origin This strain derived from AR (aganglionosis) rat found by Dr. Ikadai in 1973. AR-derived Ednrb-sl was introduced into Long-Evans(NBRP-Rat # 0557 LE.AR-EdnrbSl/Okkm) by Dr. Ozaki and this rat was provided to Dr. Agui at Hokkaido University, and inbred line was established by sib mating.
Strain characteristics Homozygous rats show auditory disorder (congenital deafness) and die of megacolon. This strain can survive longer than AGH rat and shows milder phenotype. Heterozygous (sl/+) rats don't show any phenotypes.
Breeding Conditions maintained in heterozygous condition
Genotyping Forward Primer: CCTCCTGGACTAGAGGTTCC, Reverse Primer: ACGACTTAGAAAGCTACACT Product size wild-type:511 bp, mutant:210 bp
References Dang et al. Genetic background strongly modifies the severity of symptoms of Hirschsprung disease, but not hearing loss in rats carrying Ednrb(sl) mutations. PLoS ONE (2011) vol. 6 (9) pp. e24086
Dang et al. Lymphopenia in Ednrb-deficient rat was strongly modified by genetic background. Biomed Res (2012) vol. 33 (4) pp. 249-53
Additional strain information