Strain information  NBRP Rat No: 0810  Strain name: SHR-Apoeem1Izm  Commmon Name: SHR ApoE KO1, SHR-KO(ApoE c.16_28del13)Izm Rat Genome Database Principal Investigator:  Tohru Nabika  Shimane University, School of Medicine       89-1 Enya-cho, Izumo    693-8901 Shimane     Japan Tel: 0853-20-2136    Fax: 0853-20-2135 Email: nabika@med.shimane-u.ac.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color  白色 Inbred Generations   Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected Apoe： Apolipoprotein E （Rattus norvegicus） Origin This knockout rat was generated at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University by co-introducing a guide RNA targeting the Apoe gene and a Cas9 nuclease expression plasmid into fertilized eggs of SHR/Izm rats to induce deletion of the gene sequence. The details of the target sequence are 5'-CCTGCTGTTGGTCCCATTGCTGA-3' (the 5'-side CCT is the PAM sequence, and the sequence below is the target sequence of the guide RNA). This strain has a 13-base deletion in Exon 2 of Apoe gene (5'-GCCCTGCTGTTGG-3', c.16_28del13). Strain characteristics This rat model aims to simultaneously develop hypertension and arteriosclerosis. Similar to SHR/Izm rats, these rats exhibited hypertension. Feeding a high-fat, high-cholesterol diet (HFD) significantly increased blood LDL cholesterol and triglycerides. After 8 weeks of HFD feeding, superficial lipid deposition was observed both in the aorta and mesenteric arteries, but mature atheromatous lesions similar to those seen in humans were not observed. Breeding Conditions Maintained by both homozygous sibling mating. Genotyping This can be determined by PCR using primers designed to flank the deleted region, or by sequencing the genomic DNA. The primers designed by the depositors are as follows: F: AGGACTGGGAGCTGGAATTT, R: AGCTGCTCAGGGCTATTGAA. Product size: Wild-type: 372 bp, Apoeem1 (Δ13): 359 bp. References H Matsuo, K Kawakami, H Ohara, T Kaneko, T Mashimo, T Yamada, T Nabika Apolipoprotein E-depletion accelerates arterial fat deposition in the spontaneously hypertensive rat Exp Anim. 2023 Nov 9;72(4):439-445. Additional strain information