| NBRP Rat No: 0814 |
Strain name: SHR-Prdx2em1Izm |
Commmon Name: SHR Prdx2 KO1, SHR-KO(Prdx2 c.6_13del7)Izm |
Rat Genome Database |
| Principal Investigator: |
Tohru Nabika Shimane University, School of Medicine 89-1 Enya-cho, Izumo 693-8901 Shimane Japan |
| Tel: 0853-20-2136 Fax: 0853-20-2135 |
Email: nabika@med.shimane-u.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白色 |
| Inbred Generations |
|
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
|
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Prdx2: Peroxiredoxin-2(Rattus norvegicus) |
| Origin |
This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 7-bp deletion (5'-CTCCGGC-3', c.6_13del7)in the exon2 of Prdx2 gene. |
| Strain characteristics |
Increased oxidative stress, mildly elevated blood pressure, and short life span under the salt loaded condition are observed compared with SHR. |
| Breeding Conditions |
sib mating between homozygous rats |
| Genotyping |
PCR using primers between deleted sequences or sequencing of genome DNA.
Primers are F: CCAAAAGTGACCTTGGGAAG、R: TCCTTAAAGGCACCATCCAC.
Product size: Wild-type: 162 bp, SHR-Prdx2em1Izm: 155 bp |
| References |
Mahal Z, Fujikawa K, Matsuo H, Zahid HM, Koike M, Misumi M, Kaneko T, Mashimo
T, Ohara H, Nabika T. Effects of the Prdx2 depletion on blood pressure and life
span in spontaneously hypertensive rats. Hypertens Res. 2019 Jan 17. |
| Additional strain information |
|
|