Strain information
 NBRP Rat No: 0814  Strain name: SHR-Prdx2em1Izm  Commmon Name: SHR Prdx2 KO1, SHR-KO(Prdx2 c.6_13del7)Izm Rat Genome Database
Principal Investigator:  Tohru Nabika  Shimane University, School of Medicine       89-1 Enya-cho, Izumo    693-8901 Shimane     Japan
Tel: 0853-20-2136    Fax: 0853-20-2135 Email: nabika@med.shimane-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白色
Inbred Generations  
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Prdx2： Peroxiredoxin-2（Rattus norvegicus）
Origin This strain is established at Kyoto University: By CRISPR/Cas9 system, mutation was introduced in Peroxiredoxin-2 (Prdx2) gene of SHR/Izm rat. This KO rat strain has 7-bp deletion （5'-CTCCGGC-3', c.6_13del7）in the exon2 of Prdx2 gene.
Strain characteristics Increased oxidative stress, mildly elevated blood pressure, and short life span under the salt loaded condition are observed compared with SHR.
Breeding Conditions sib mating between homozygous rats
Genotyping PCR using primers between deleted sequences or sequencing of genome DNA. Primers are F: CCAAAAGTGACCTTGGGAAG、R: TCCTTAAAGGCACCATCCAC. Product size: Wild-type: 162 bp, SHR-Prdx2em1Izm: 155 bp
References Mahal Z, Fujikawa K, Matsuo H, Zahid HM, Koike M, Misumi M, Kaneko T, Mashimo
T, Ohara H, Nabika T. Effects of the Prdx2 depletion on blood pressure and life
span in spontaneously hypertensive rats. Hypertens Res. 2019 Jan 17.
Additional strain information