NBRP Rat No: 0809 |
Strain name: F344-Tg(Dct-lacZ)9Kyo |
Commmon Name: Dct-LacZ |
Rat Genome Database |
Principal Investigator: |
Takashi Kuramoto Graduate School of Medicine, Kyoto University Yoshidakonoe-cho, Sakyo-ku 606-8501 Kyoto Japan |
Tel: 075-753-4494 Fax: 075-753-4409 |
Email: kuramot@anim.med.kyoto-u.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
albino |
Inbred Generations |
N2 |
Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
dopachrome tautomerase (Dct), lacZ |
Origin |
The constract was made by connecting a 3,659 bp DNA fragment of rat Dct (dopachrome tautomerase) gene (5'-3237 to 422) with the upstream of lacZ gene. Dct gene was derived from F344/Stm. Background strain: F344/NSlc, plasmid: pLacZ-Basic (Clontech Laboratories) |
Strain characteristics |
Dct gene is considered to be expressed specifically in melanocytes. The expression pattern of Dct gene in this strain is under analysis. |
Breeding Conditions |
Good breeding performance. Maintained by mating between hemizygous (+/-) and wild-type rats. |
Genotyping |
PCR for detecting LacZ gene in the transgene.
Primers: LacZ-F(ATATGTGGCGGTGATGAGCGGCA), LacZ-R(GCGCTCCACAGTTTCGGGTTT), PCR: Amp-direct method. 94℃ 30 sec, 60℃ 30 sec, 72℃ 60 sec. 35 cycles. Product size: 307 bp.
|
References |
|
Additional strain information |
|
|