Strain information
 NBRP Rat No: 0809  Strain name: F344-Tg(Dct-lacZ)9Kyo  Commmon Name: Dct-LacZ Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Graduate School of Medicine, Kyoto University       Yoshidakonoe-cho, Sakyo-ku    606-8501 Kyoto     Japan
Tel: 075-753-4494    Fax: 075-753-4409 Email: kuramot@anim.med.kyoto-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino
Inbred Generations  N2
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected dopachrome tautomerase (Dct), lacZ
Origin The constract was made by connecting a 3,659 bp DNA fragment of rat Dct (dopachrome tautomerase) gene (5'-3237 to 422) with the upstream of lacZ gene. Dct gene was derived from F344/Stm. Background strain: F344/NSlc, plasmid: pLacZ-Basic (Clontech Laboratories)
Strain characteristics Dct gene is considered to be expressed specifically in melanocytes. The expression pattern of Dct gene in this strain is under analysis.
Breeding Conditions Good breeding performance. Maintained by mating between hemizygous (+/-) and wild-type rats.
Genotyping PCR for detecting LacZ gene in the transgene. Primers: LacZ-F(ATATGTGGCGGTGATGAGCGGCA), LacZ-R(GCGCTCCACAGTTTCGGGTTT), PCR: Amp-direct method. 94℃ 30 sec, 60℃ 30 sec, 72℃ 60 sec. 35 cycles. Product size: 307 bp.
References
Additional strain information