| NBRP Rat No: 0840 |
Strain name: LE-Tg(Gt(ROSA)26Sor-CAG-COP4*C167A/YFP*)1Jfhy |
Commmon Name: LE-Tg(Gt(ROSA)26Sor-CAG-COP4*C167A)1Jfhy |
Rat Genome Database |
| Principal Investigator: |
Hiromu Yawo Tohoku University 2-1-1, Katahira, Aoba-ku, Sendai-shi 980-8577 Miyagi Japan |
| Tel: 022-217-6208 Fax: 022-217-6211 |
Email: hiromu.yawo.c7@tohoku.ac.jp (担当 五十嵐 敬幸:hirobio@med.tohoku.ac.jp) |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白黒 |
| Inbred Generations |
F1 |
| Usage Restrictions |
Any form of publications of data resulting from the use of the BIOROGICAL RESOURCE should reference the following DEPOSITOR’s papers. “Igarashi, H., Ikeda, K., Onimaru, H., Kaneko, R., Koizumi, K., Beppu, K., Nishizawa, K., Takahashi, Y., Kato, F., Matsui, K., Kobayashi, K., Yanagawa, Y., Muramatsu, S. I., Ishizuka, T, Yawo, H. Targeted expression of step-function opsins in transgenic rats for optogenetic studies. Scientific Reports 8(1):5435 (2018)” In publishing, an acknowledgment to the DEPOSITOR is requested. The BIOROGICAL RESOURCE should be used under the following rules. 1) Any profit organizations cannot use the BIOLOGICAL RESOURCE without contracting license agreements with TOHOKU University. 2) All characteristics of the BIOLOGICAL RESOURCE are not fully known since it was obtained through scientific researches. The recipients should agree that TOHOKU University and the DEPOSITOR will not provide any assurance for the BIOLOGICAL RESOURCE and will not bear any responsibility for the outcome of the use of the BIOLOGICAL RESOUCES without Obligation for Compensation. 3) Either the BIOLOGICAL RESOURCE or the biological materials included in the BIOLOGICAL RESOURCES should not be used in humans or in the edibles creatures even for the diagnosis. 4) The BIOLOGICAL RESOURCE should not be redistributed without the permission by TOHOKU University.
|
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
ROSA26/CAG-floxesSTOP-ChRFR(C167A) BAC. Channelrhodopsin fast receiverをCOP4*C167Aと表記。YFP* (Venus): yellow fluorescent protein variant |
| Origin |
Back ground strain: Iar:Long-Evans (Kumagai-shigeyasu Co.,Ltd), Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), Neo resistance(V00618, E. coli), loxP sequence (bacteriophage), FRT sequence (Yeast), adenylation signal sequence (SV40-derived gene unit), immediate-early enhancer(CMV), β-actin, promoter(chicken), β globin exon sequence(rabbit), β globin polyA sequence(rabbit), and Channelrhodopsin fastreceiver(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 1 |
| Strain characteristics |
In this strain, ChRFR(COP4*C167A), modified photosensitivity cation channel, is expressed ubiquitouslyin the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin.
There is no differences between line 1 and 2 except for copy nuber. |
| Breeding Conditions |
mating with Long-Evans rats |
| Genotyping |
・Primer set...Neo-F1 : 5’- ctatgactgggcacaacagacaat -3', Neo-R1 : 5’- aactcgtcaagaaggcgatagaag -3’
・product size: Tg(+) 726bp
・94℃ for 2min, 98℃ for 10sec and 68℃ for 60sec (30 cycles), 4℃
|
| References |
Ikeda K, Igarashi H, Yawo H, Kobayashi K, Arata S, Kawakami K, Izumizaki M, Onimaru H.
Optogenetic analysis of respiratory neuronal networks in the ventral medulla of neonatal rats producing channelrhodopsin in Phox2b-positive cells.
Pflugers Arch. 2019 Dec;471(11-12):1419-1439.
Igarashi H, Ikeda K, Onimaru H, Kaneko R, Koizumi K, Beppu K, Nishizawa K, Takahashi Y, Kato F, Matsui K, Kobayashi K, Yanagawa Y, Muramatsu SI, Ishizuka T, Yawo H.
Targeted expression of step-function opsins in transgenic rats for optogenetic studies.
Sci Rep. 2018 Apr 3;8(1):5435. |
| Additional strain information |
|
|
|