Strain information
 NBRP Rat No: 0840  Strain name: LE-Tg(Gt(ROSA)26Sor-CAG-COP4*C167A/YFP*)1Jfhy  Commmon Name: LE-Tg(Gt(ROSA)26Sor-CAG-COP4*C167A)1Jfhy Rat Genome Database
Principal Investigator:  Hiromu Yawo  Tohoku University       2-1-1, Katahira, Aoba-ku, Sendai-shi    980-8577 Miyagi     Japan
Tel: 022-217-6208    Fax: 022-217-6211 Email: hiromu.yawo.c7@tohoku.ac.jp (担当 五十嵐 敬幸:hirobio@med.tohoku.ac.jp)
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白黒
Inbred Generations  F1
Usage Restrictions  Any form of publications of data resulting from the use of the BIOROGICAL RESOURCE should reference the following DEPOSITOR’s papers.
“Igarashi, H., Ikeda, K., Onimaru, H., Kaneko, R., Koizumi, K., Beppu, K., Nishizawa, K., Takahashi, Y., Kato, F., Matsui, K., Kobayashi, K., Yanagawa, Y., Muramatsu, S. I., Ishizuka, T, Yawo, H. Targeted expression of step-function opsins in transgenic rats for optogenetic studies. Scientific Reports 8(1):5435 (2018)”
In publishing, an acknowledgment to the DEPOSITOR is requested.
The BIOROGICAL RESOURCE should be used under the following rules.
1) Any profit organizations cannot use the BIOLOGICAL RESOURCE without contracting license agreements with TOHOKU University.
2) All characteristics of the BIOLOGICAL RESOURCE are not fully known since it was obtained through scientific researches. The recipients should agree that TOHOKU University and the DEPOSITOR will not provide any assurance for the BIOLOGICAL RESOURCE and will not bear any responsibility for the outcome of the use of the BIOLOGICAL RESOUCES without Obligation for Compensation.
3) Either the BIOLOGICAL RESOURCE or the biological materials included in the BIOLOGICAL RESOURCES should not be used in humans or in the edibles creatures even for the diagnosis.
4) The BIOLOGICAL RESOURCE should not be redistributed without the permission by TOHOKU University.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 神経科学
 Control Strain  Marker Strain
Gene Affected ROSA26/CAG-floxesSTOP-ChRFR(C167A) BAC. Channelrhodopsin fast receiverをCOP4*C167Aと表記。YFP* (Venus): yellow fluorescent protein variant
Origin Back ground strain: Iar:Long-Evans (Kumagai-shigeyasu Co.,Ltd), Transgene: ROSA26 (mouse ROSA26 BAC: RP23 244D9), Neo resistance(V00618, E. coli), loxP sequence (bacteriophage), FRT sequence (Yeast), adenylation signal sequence (SV40-derived gene unit), immediate-early enhancer(CMV), β-actin, promoter(chicken), β globin exon sequence(rabbit), β globin polyA sequence(rabbit), and Channelrhodopsin fastreceiver(COP4*C167A) (Chlamydomonas reinhardtii) fused with YFP* (Venus). Copy number: 1
Strain characteristics In this strain, ChRFR(COP4*C167A), modified photosensitivity cation channel, is expressed ubiquitouslyin the presence of exogenous Cre protein. The ChRFR(COP4*C167A), one of the channel rhodopsin (step-function opsin, SFO), opens under blue light and is closed under yellow light. The Venus (YFP*) is tagged with channel rhodopsin. There is no differences between line 1 and 2 except for copy nuber.
Breeding Conditions mating with Long-Evans rats
Genotyping ・Primer set...Neo-F1 : 5’- ctatgactgggcacaacagacaat -3', Neo-R1 : 5’- aactcgtcaagaaggcgatagaag -3’ ・product size: Tg(+) 726bp ・94℃ for 2min, 98℃ for 10sec and 68℃ for 60sec (30 cycles), 4℃
References Ikeda K, Igarashi H, Yawo H, Kobayashi K, Arata S, Kawakami K, Izumizaki M, Onimaru H.
Optogenetic analysis of respiratory neuronal networks in the ventral medulla of neonatal rats producing channelrhodopsin in Phox2b-positive cells.
Pflugers Arch. 2019 Dec;471(11-12):1419-1439.

Igarashi H, Ikeda K, Onimaru H, Kaneko R, Koizumi K, Beppu K, Nishizawa K, Takahashi Y, Kato F, Matsui K, Kobayashi K, Yanagawa Y, Muramatsu SI, Ishizuka T, Yawo H.
Targeted expression of step-function opsins in transgenic rats for optogenetic studies.
Sci Rep. 2018 Apr 3;8(1):5435.
Additional strain information