Strain information
 NBRP Rat No: 0843  Strain name: LE-Tg(Drd2-cre)487-3Koba  Commmon Name: Drd2-Cre RecBAC 487-3 Rat Genome Database
Principal Investigator:  Kazuto Kobayashi  Fukushima Medical University       1 Hikarigaoka Fukushima-shi    960-1295 Fukushima     Japan
Tel: 024-547-1667    Fax: 024-548-3936 Email: kazuto@fmu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白黒
Inbred Generations  F5 (April 2016)
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 脳神経科学一般
 Control Strain  Marker Strain
Gene Affected cre: cre recombinase protein, Drd2: dopamine receptor D2
Origin Background strain: Long-Evans rat (Iar:Long-Evans) This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Drd2 gene) into Long-Evans rat's fertile eggs. Detailed information of BAC: Drd2, CH230-11B15 from the CHORI-230 Female Brown Norway rat BAC Library (BACPAC Resources Center, Children’s Hospital Oakland Research Institute)
Strain characteristics Transgenic rat. This strain expresses Cre recombinase under control of Drd2 promoter.
Breeding Conditions Maintained by mating heterozygous rats with Long-Evans rats. Good breeding performance.
Genotyping Identification of cre sequence by PCR. primers...F:TCGATGCAACGAGTGATGAG R:TTCGGCTATACGTAACAGGG, PCR condition (TaKaRa Taq): 94℃ 5min, 94℃ (30cycle) 20s, 56℃ 30s, 72℃ 30s, 4℃. product size：482bp
References Monitoring and Updating of Action Selection for Goal-Directed Behavior through the Striatal Direct and Indirect Pathways. Nonomura S, Nishizawa K, Sakai Y, Kawaguchi Y, Kato S, Uchigashima M, Watanabe M, Yamanaka K, Enomoto K, Chiken S, Sano H, Soma S, Yoshida J, Samejima K, Ogawa M, Kobayashi K, Nambu A, Isomura Y, Kimura M. Neuron. 2018 Sep 19;99(6):1302-1314.e5. doi: 10.1016/j.neuron.2018.08.002. Epub 2018 Aug 23. PMID: 30146299
Additional strain information