Strain information
 NBRP Rat No: 0837  Strain name: LE-Rosa26em1(CAG-COP4*/EGFP)Kyo  Commmon Name: LE-Rosa26em1(ChR90)Kyo Rat Genome Database
Principal Investigator:  Tadashi Isa  National Institute for Physiological Sciences       38 Nishigonaka Myodaiji, Okazaki    444-8585 Aichi,     Japan
Tel: 0564-55-7764    Fax: 0564-55-7766 Email: seri0722@gmail.com
Preservation Status:   Embryo        Sperm       Living Animals ?s_Behavior=1 ?s_Behavior=1
Coat Color  白と黒の混合
Inbred Generations  F3
Usage Restrictions  In publishing the serearch results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Yoshimi, et al, Nature Communications, 2016

The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The RECIPIENT must agree on collaborative research with MASAAKI OGAWA and TOMOJI MASHIMO. The first form of publications of data resulting from the use of the BIOLOGICAL RESOURCE require co-authorship.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 光遺伝学
 Control Strain  Marker Strain
Gene Affected CAG-loxP-ChR90-loxP-EGFP, COP4*: Stigeoclonium helveticum-derived channelrhodopsin (Chronos, ChR90), EGFP (Enhanced green fluorescent protein)
Origin This strain was established by using CISPR-Cas9 and SS-ODN (Yoshimi, et al, 2016) at Kyoto University. ChR90/EGFP fusion gene (Klapoetke, et al, 2014) sequence (between loxP sequences) under CAG promoter is knock-in at the Rosa26 locus. Background strain: Long-Evans strain (charles river)
Strain characteristics ChR90-EGFP is expressed in the presence of Cre.　When Cre is expressed in the cerebral cortex, strong GFP expression is detected in a part of glial cells and vessels. In neurons, the expression levels of GFP is weaker than glial cells. The pattern of GFP expression in other organ is not examined.
Breeding Conditions maintain in heterozygous condition.
Genotyping Identified by PCR analysis (primers...forward: ACAGGCCGATCATGAAGAAC, Reverse: ATCCACCTGAGCAACCTGAC). product size: 151 bp (KI rats)
References Klapoetke, et al, Nature Methods, 2014
Yoshimi, et al, Nature Communications, 2016
Additional strain information