NBRP Rat No: 0837 |
Strain name: LE-Rosa26em1(CAG-COP4*/EGFP)Kyo |
Commmon Name: LE-Rosa26em1(ChR90)Kyo |
Rat Genome Database |
Principal Investigator: |
Tadashi Isa National Institute for Physiological Sciences 38 Nishigonaka Myodaiji, Okazaki 444-8585 Aichi, Japan |
Tel: 0564-55-7764 Fax: 0564-55-7766 |
Email: seri0722@gmail.com |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
白と黒の混合 |
Inbred Generations |
F3 |
Usage Restrictions |
In publishing the serearch results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Yoshimi, et al, Nature Communications, 2016
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. The RECIPIENT must agree on collaborative research with MASAAKI OGAWA and TOMOJI MASHIMO. The first form of publications of data resulting from the use of the BIOLOGICAL RESOURCE require co-authorship. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
CAG-loxP-ChR90-loxP-EGFP, COP4*: Stigeoclonium helveticum-derived channelrhodopsin (Chronos, ChR90), EGFP (Enhanced green fluorescent protein) |
Origin |
This strain was established by using CISPR-Cas9 and SS-ODN (Yoshimi, et al, 2016) at Kyoto University. ChR90/EGFP fusion gene (Klapoetke, et al, 2014) sequence (between loxP sequences) under CAG promoter is knock-in at the Rosa26 locus. Background strain: Long-Evans strain (charles river) |
Strain characteristics |
ChR90-EGFP is expressed in the presence of Cre. When Cre is expressed in the cerebral cortex, strong GFP expression is detected in a part of glial cells and vessels. In neurons, the expression levels of GFP is weaker than glial cells. The pattern of GFP expression in other organ is not examined. |
Breeding Conditions |
maintain in heterozygous condition. |
Genotyping |
Identified by PCR analysis (primers...forward: ACAGGCCGATCATGAAGAAC, Reverse: ATCCACCTGAGCAACCTGAC). product size: 151 bp (KI rats) |
References |
Klapoetke, et al, Nature Methods, 2014
Yoshimi, et al, Nature Communications, 2016 |
Additional strain information |
|
|