Strain information  NBRP Rat No: 0851  Strain name: SHR-Apoeem1Izm Prdx2em1Izm  Commmon Name: Rat Genome Database Principal Investigator:  Tohru Nabika  Shimane University, School of Medicine       89-1 Enya-cho, Izumo    693-8901 Shimane     Japan Tel: 0853-20-2136    Fax: 0853-20-2135 Email: nabika@med.shimane-u.ac.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color  白色 Inbred Generations   Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected Apoe： Apolipoprotein E（Rattus norvegicus）、Prdx2： Peroxiredoxin-2（Rattus norvegicus） Origin Apoe knockout SHR/Izm rats (SHR-Apoeem1Izm, NBRP-Rat No.0810) and Prdx2 knockout SHR/Izm rats (SHR-Prdx2em1Izm, NBRP-Rat No.0814) were generated by co-introducing a guide RNA targeting Apoe or Prdx2 gene and a Cas9 nuclease expression plasmid into fertilized eggs of SHR/Izm rats to induce deletion of the gene sequence at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. This strain, Apoe-Prdx2 double knockout SHR/Izm rat was generated by crossing the Apoe and Prdx2 knockout SHR/Izm rat strains by the depositor, after introduced into the Department of Experimental Animals, Shimane University. There is a 13-base deletion in exon 2 of Apoe (5'-GCCCTGCTGTTGG-3', c.16_28del13), and a 7-base deletion in exon 2 of Prdx2 (5'-CTCCGGC-3', c.6_13del7). Details of the target sequences are as follows: Apoe: 5'-CCTGCTGTTGGTCCCATTGCTGA-3' (5'-side CCT is the PAM sequence, the sequence below is the target sequence of the guide RNA), Prdx2: 5'-CCTCCGGCAACGCGCACATCGGA-3' (5'-side CCT is the PAM sequence, the sequence below is the target sequence of the guide RNA) Strain characteristics The effects of increased oxidative stress on the development of atherosclerosis were examined in SHR/Izm rats lacking both the Apoe gene and Prdx2 gene. A high-fat, high-cholesterol diet (HFD) did not result in mature atheroma. Furthermore, salt loading promoted the progression of fat deposition but did not promote the development of atheroma. Breeding Conditions Maintained by mating siblings of homozygous deletion of Apoe and Prdx2 genes. Genotyping This can be determined by PCR using primers designed to flank the deletion region, or by sequencing of genomic DNA. The primers designed by the depositor are as follows: For Apoe deletion confirmation (F: AGGACTGGGAGCTGGAATTT, R: AGCTGCTCAGGGCTATTGAA), for Prdx2 deletion confirmation (F: CCAAAAGTGACCTTGGGAAG, R: TCCTTAAAGGCACCATCCAC). Product size for Apoe: Wild-type: 372 bp, Apoeem1 (Δ13): 359 bp. For Prdx2: Wild-type: 162 bp, Prdx2em1 (Δ7): 155 bp References H Matsuo, K Kawakami, H Ohara, T Kaneko, T Mashimo, T Yamada, T Nabika Apolipoprotein E-depletion accelerates arterial fat deposition in the spontaneously hypertensive rat Exp Anim. 2023 Nov 9;72(4):439-445. Additional strain information