| NBRP Rat No: 0853 |
Strain name: LE-Tg(Pvalb-cre)2-28Koba |
Commmon Name: PVA-Cre RecBAC 2-28ラット、LE-Tg(PVA-cre)2-28Koba |
Rat Genome Database |
| Principal Investigator: |
Kazuto Kobayashi Fukushima Medical University 1 Hikarigaoka Fukushima-shi 960-1295 Fukushima Japan |
| Tel: 024-547-1667 Fax: 024-548-3936 |
Email: kazuto@fmu.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白黒 |
| Inbred Generations |
F5 (October 2016) |
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. The user is required for a collaborative research with the depositor. Consult with the depositor about details beforehand.
|
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
cre: cre recombinase protein, Pvalb:parvalbumin |
| Origin |
Background strain: Long-Evans rat (Iar:Long-Evans)
This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs.
Detailed information of BAC: Parvalbumin neurons in the forebrain as revealed by parvalbumin-Cre transgenic mice. Tanahira C, Higo S, Watanabe K, Tomioka R, Ebihara S, Kaneko T, Tamamaki N. Neurosci Res. 2009 Mar;63(3):213-23. doi: 10.1016/j.neures.2008.12.007. Epub 2009 Jan 9. PMID:19167436 |
| Strain characteristics |
Transgenic rat. This strain expresses Cre recombinase under control of Pvalb (parvalbumin). |
| Breeding Conditions |
Maintained by mating heterozygous Tg-rats with Long Evans rat. Good breerding performance. |
| Genotyping |
Identification of cre sequence by PCR. Primers: Forward (TCGATGCAACGAGTGATGAG ) and Reverse (TTCGGCTATACGTAACAGGG). PCR condition: TaKaRa Taq, 94℃ 5min↓ 94℃ (30cycle) 20s 56℃ 30s 72℃ 30s 4℃↓. Product size: 482 bp |
| References |
N Matsushita, S Kato, K Nishizawa, M Sugawara, K Takeuchi, Y Miyasaka, T Mashimo, K Kobayashi
Protocol for highly selective transgene expression through the flip-excision switch system by using a unilateral spacer sequence in rodents
STAR Protoc. 2023 Dec 15;4(4):102667.
N Matsushita, S Kato, K Nishizawa, M Sugawara, K Takeuchi, Y Miyasaka, T Mashimo, K Kobayashi
Highly selective transgene expression through the flip-excision switch system by using a unilateral spacer sequence
Cell Rep Methods. 2023 Jan 18;3(2):100393.
Oh YM, Karube F, Takahashi S, Kobayashi K, Takada M, Uchigashima M, Watanabe M, Nishizawa K, Kobayashi K, Fujiyama F, "Using a novel PV-Cre rat model to characterize pallidonigral cells and their terminations", Brain Struct Funct, 222(5), 2359-2378, 2017 Jul |
| Additional strain information |
|
|