Strain information
 NBRP Rat No: 0853  Strain name: LE-Tg(Pvalb-cre)2-28Koba  Commmon Name: PVA-Cre RecBAC 2-28ラット、LE-Tg(PVA-cre)2-28Koba Rat Genome Database
Principal Investigator:  Kazuto Kobayashi  Fukushima Medical University       1 Hikarigaoka Fukushima-shi    960-1295 Fukushima     Japan
Tel: 024-547-1667    Fax: 024-548-3936 Email: kazuto@fmu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白黒
Inbred Generations  F5 (October 2016)
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The user is required for a collaborative research with the depositor. Consult with the depositor about details beforehand.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 脳神経科学一般
 Control Strain  Marker Strain
Gene Affected cre: cre recombinase protein, Pvalb:parvalbumin
Origin Background strain: Long-Evans rat (Iar:Long-Evans) This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs. Detailed information of BAC: Parvalbumin neurons in the forebrain as revealed by parvalbumin-Cre transgenic mice. Tanahira C, Higo S, Watanabe K, Tomioka R, Ebihara S, Kaneko T, Tamamaki N. Neurosci Res. 2009 Mar;63(3):213-23. doi: 10.1016/j.neures.2008.12.007. Epub 2009 Jan 9. PMID:19167436
Strain characteristics Transgenic rat. This strain expresses Cre recombinase under control of Pvalb (parvalbumin).
Breeding Conditions Maintained by mating heterozygous Tg-rats with Long Evans rat. Good breerding performance.
Genotyping Identification of cre sequence by PCR. Primers: Forward (TCGATGCAACGAGTGATGAG ) and Reverse (TTCGGCTATACGTAACAGGG). PCR condition: TaKaRa Taq, 94℃ 5min↓ 94℃ (30cycle) 20s 56℃ 30s 72℃ 30s 4℃↓. Product size: 482 bp
References Oh YM, Karube F, Takahashi S, Kobayashi K, Takada M, Uchigashima M, Watanabe M, Nishizawa K, Kobayashi K, Fujiyama F, "Using a novel PV-Cre rat model to characterize pallidonigral cells and their terminations", Brain Struct Funct, 222(5), 2359-2378, 2017 Jul
Additional strain information