Strain information

The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
The user is required for a collaborative research with the depositor. Consult with the depositor about details beforehand.

cre: cre recombinase protein, Pvalb:parvalbumin

Background strain: Long-Evans rat (Iar:Long-Evans) This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs. Detailed information of BAC: Parvalbumin neurons in the forebrain as revealed by parvalbumin-Cre transgenic mice. Tanahira C, Higo S, Watanabe K, Tomioka R, Ebihara S, Kaneko T, Tamamaki N. Neurosci Res. 2009 Mar;63(3):213-23. doi: 10.1016/j.neures.2008.12.007. Epub 2009 Jan 9. PMID:19167436

Transgenic rat. This strain expresses Cre recombinase under control of Pvalb (parvalbumin).

Maintained by mating heterozygous Tg-rats with Long Evans rat. Good breerding performance.

Identification of cre sequence by PCR. Primers: Forward (TCGATGCAACGAGTGATGAG ) and Reverse (TTCGGCTATACGTAACAGGG). PCR condition: TaKaRa Taq, 94℃ 5min↓ 94℃ (30cycle) 20s 56℃ 30s 72℃ 30s 4℃↓. Product size: 482 bp

N Matsushita, S Kato, K Nishizawa, M Sugawara, K Takeuchi, Y Miyasaka, T Mashimo, K Kobayashi
Protocol for highly selective transgene expression through the flip-excision switch system by using a unilateral spacer sequence in rodents
STAR Protoc. 2023 Dec 15;4(4):102667.

N Matsushita, S Kato, K Nishizawa, M Sugawara, K Takeuchi, Y Miyasaka, T Mashimo, K Kobayashi
Highly selective transgene expression through the flip-excision switch system by using a unilateral spacer sequence
Cell Rep Methods. 2023 Jan 18;3(2):100393.

Oh YM, Karube F, Takahashi S, Kobayashi K, Takada M, Uchigashima M, Watanabe M, Nishizawa K, Kobayashi K, Fujiyama F, "Using a novel PV-Cre rat model to characterize pallidonigral cells and their terminations", Brain Struct Funct, 222(5), 2359-2378, 2017 Jul