NBRP Rat No: 0865 |
Strain name: F344-Tg(CAG-EGFP,Acr-EGFP)2Osb |
Commmon Name: rGBGS #2, F344-Tg(CAG/Acr?EGFP)GBGS002Osb |
Rat Genome Database |
Principal Investigator: |
Masahito Ikawa Osaka University 3-1 Yamadaoka 565-0871 Suita-shi Osaka JAPAN |
Tel: 06-6879-8375 Fax: 06-6879-8376 |
Email: mta-egr@biken.osaka-u.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
albino |
Inbred Generations |
情報なし |
Usage Restrictions |
The RECIPIENT of BIOLOGICAL RESOURCE shall obtaina prior written consent use of it from the DEPOSITOR. RECOPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following Literature(s) designated by the DEPOSITOR is requested (Isotani A, Yamagata K, Okabe M and Ikawa M. Generation of Hprt-disrupted rat through mouse←rat ES chimeras. Sci Rep. 2016 Apr 11;6:24215.). The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
EGFP, CAG promoter, Acr (acrosin) |
Origin |
This double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data). |
Strain characteristics |
GFR protein is expressed throughout the body including testes and sperm. However, epididymis does not express GFP fluorescence. Homozygous Tg rats can be generated. |
Breeding Conditions |
sib mating between Tg rats |
Genotyping |
Tg rats are checked by GFP fluorescence using the handy light, and PCR in regards to Acr-EGFP.
PCR primer for checking Acr-EGFP
F (5'→3'): tggaggtcttccgacagagg
R (5'→3'): catggcagccagcatatggg
94℃、2min
94℃、30sec
60℃、30sec
72℃、1min
(35 cycles)
16℃、∞
DNA fragment size is approximately 1450 bp. |
References |
(*)Isotani A, Yamagata K, Okabe M and Ikawa M.
Generation of Hprt-disrupted rat through mouse←rat ES chimeras.
Sci Rep. 2016 Apr 11;6:24215. doi: 10.1038/srep24215.
|
Additional strain information |
|
|