Strain information
 NBRP Rat No: 0865  Strain name: F344-Tg(CAG-EGFP,Acr-EGFP)2Osb  Commmon Name: rGBGS #2, F344-Tg(CAG/Acr?EGFP)GBGS002Osb Rat Genome Database
Principal Investigator:  Masahito Ikawa  Osaka University       3-1 Yamadaoka    565-0871 Suita-shi Osaka     JAPAN
Tel: 06-6879-8375    Fax: 06-6879-8376 Email: mta-egr@biken.osaka-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals ?s_Development=1 ?s_Development=1
Coat Color  albino
Inbred Generations  情報なし
Usage Restrictions  The RECIPIENT of BIOLOGICAL RESOURCE shall obtaina prior written consent use of it from the DEPOSITOR.
RECOPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University.
In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following Literature(s) designated by the DEPOSITOR is requested (Isotani A, Yamagata K, Okabe M and Ikawa M. Generation of Hprt-disrupted rat through mouse←rat ES chimeras. Sci Rep. 2016 Apr 11;6:24215.).
The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected EGFP, CAG promoter, Acr (acrosin)
Origin This double transgenic strain was established by co-injection of CAG-EGFP and mouse Acr-EGFP into F344/NSlc at Osaka University (over 5 generations, Dec 2016). There are two lines; GBGS(green body, green sperm)#2 and GBGS #6, but copy numbers and insertion site are not identified. Both lines show enough intensity of GFP fluorescence (no quantitative data).
Strain characteristics GFR protein is expressed throughout the body including testes and sperm. However, epididymis does not express GFP fluorescence. Homozygous Tg rats can be generated.
Breeding Conditions sib mating between Tg rats
Genotyping Tg rats are checked by GFP fluorescence using the handy light, and PCR in regards to Acr-EGFP. PCR primer for checking Acr-EGFP F (5'→3'): tggaggtcttccgacagagg R (5'→3'): catggcagccagcatatggg 94℃、2min 94℃、30sec 60℃、30sec 72℃、1min (35 cycles) 16℃、∞ DNA fragment size is approximately 1450 bp.
References (*)Isotani A, Yamagata K, Okabe M and Ikawa M.
Generation of Hprt-disrupted rat through mouse←rat ES chimeras.
Sci Rep. 2016 Apr 11;6:24215. doi: 10.1038/srep24215.
Additional strain information