Strain information
 NBRP Rat No: 0870  Strain name: STOCK Aspaem34Kyo Hcn1A354V/Kyo  Commmon Name: Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Tokyo University of Agriculture       1737 Funako, Atsugi,    243-0034 Kanagawa     Japan
Tel: 046-270-6583    Fax: 046-270-6585 Email: tk206782@nodai.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白色
Inbred Generations  F6
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other double mutant rat (WTC/Kyo and F344-Aspaem34Kyo)
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Aspartoacylase (Aspa), Hyperpolarization-activated cyclic nucleotide-gated channel 1 (Hcn1)
Origin This double mutant strain was established by crossing WTC/Kyo (NBRP Rat No. 0020) and F344-Aspaem34Kyo (NBRP Rat No. 0806). WTC/Kyo has a missense mutation (Hcn1A354V) in Hcn1 (Hyperpolarization-activated cyclic nucleotide-gated channel 1) gene and F344-Aspaem34Kyo has a 16-bp deletion in the exon4 of Aspa (Aspartoacylase) gene (c.622_637del).
Strain characteristics This strain has A354V mutation in Hcn1 gene and c.622_637del mutaion in Aspa gene. This double mutant rats show tremor behavior resembling those in TRM/Kyo rats at 3 weeks of age, and this tremor was suppressed by drugs therapeutic for ET (Essential tremor). The Aspa/Hcn1-double mutantcan serve as good animal models of human ET.
Breeding Conditions mating between double mutant rats
Genotyping 1. Aspa mutation (c.622_637del) rAspa-e3-KO-F:aagaaagatgttttcaattttgttca, rAspa-e3-KO-R:tctactgtgccagcaggaag, PRODUCT SIZE:wild 151 bp, KO 135 bp 2. Hcn1 mutation (A354V) rHcn1-e4-KO-F:ttccaaccatttgcctacaa, rHcn1-e4-KO-R:gccataaccaatgcacagc, PRODUCT SIZE:wild 239 bp Restriction enzyme treatment by AvaII
References Ai N,Miyuu T,Saki S,Naofumi K,Mayuko Y,Yusaku Y,Toshito S,Tetsushi S,Takashi Y,Mituru K,Shigeo T,Yukihiro O,and Tahashi K.2016.
Involvement of aspartoacylase in tremor expression in rats.
Exp.Anim65(3),293-301
Additional strain information