| NBRP Rat No: 0870 |
Strain name: STOCK Aspaem34Kyo Hcn1A354V/Kyo |
Commmon Name: |
Rat Genome Database |
| Principal Investigator: |
Takashi Kuramoto Tokyo University of Agriculture 1737 Funako, Atsugi, 243-0034 Kanagawa Japan |
| Tel: 046-270-6583 Fax: 046-270-6585 |
Email: tk206782@nodai.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白色 |
| Inbred Generations |
F6 |
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Aspartoacylase (Aspa), Hyperpolarization-activated cyclic nucleotide-gated channel 1 (Hcn1) |
| Origin |
This double mutant strain was established by crossing WTC/Kyo (NBRP Rat No. 0020) and F344-Aspaem34Kyo (NBRP Rat No. 0806). WTC/Kyo has a missense mutation (Hcn1A354V) in Hcn1 (Hyperpolarization-activated cyclic nucleotide-gated channel 1) gene and F344-Aspaem34Kyo has a 16-bp deletion in the exon4 of Aspa (Aspartoacylase) gene (c.622_637del). |
| Strain characteristics |
This strain has A354V mutation in Hcn1 gene and c.622_637del mutaion in Aspa gene. This double mutant rats show tremor behavior resembling those in TRM/Kyo rats at 3 weeks of age, and this tremor was suppressed by drugs therapeutic for ET (Essential tremor). The Aspa/Hcn1-double mutantcan serve as good animal models of human ET. |
| Breeding Conditions |
mating between double mutant rats |
| Genotyping |
1. Aspa mutation (c.622_637del)
rAspa-e3-KO-F:aagaaagatgttttcaattttgttca, rAspa-e3-KO-R:tctactgtgccagcaggaag, PRODUCT SIZE:wild 151 bp, KO 135 bp
2. Hcn1 mutation (A354V)
rHcn1-e4-KO-F:ttccaaccatttgcctacaa, rHcn1-e4-KO-R:gccataaccaatgcacagc, PRODUCT SIZE:wild 239 bp
Restriction enzyme treatment by AvaII |
| References |
Ai N,Miyuu T,Saki S,Naofumi K,Mayuko Y,Yusaku Y,Toshito S,Tetsushi S,Takashi Y,Mituru K,Shigeo T,Yukihiro O,and Tahashi K.2016.
Involvement of aspartoacylase in tremor expression in rats.
Exp.Anim65(3),293-301 |
| Additional strain information |
|
|