Strain information
 NBRP Rat No: 0883  Strain name: F344-Il2rgem1Iexas  Commmon Name: X-SCID, F344-Il2rgem1Iexas Rat Genome Database
Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan
Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino
Inbred Generations  N3
Usage Restrictions  The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected interleukin 2 receptor gamma (Il2rg)
Origin 【This strain is provided by the University of Tokyo (cooperative facility)】 This strain was established by CRISPR/Cas9 targeting rat Il2rg gene using electroporation. background strain: F344/Jcl. gRNA: CCAACCTCACTATGCACTATAGG (PAM sequence: CCA). Cas9: mRNA transcripted from T7-NLS hCas9-pA (RDB13130). Off target analysis has not yet been conducted.
Strain characteristics This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion of Il2rg gene. This strain grows normally under SPF condition.
Breeding Conditions mating between hemizygous male and homozygous female rats
Genotyping PCR: primers (TTGCTGACTTCTATGGACCTTAAA and TTCATCTGGTCTGAACTGATAACTTAT). product size: wild 292 bp and mutant 287 bp
References Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T.
Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases.
PLoS One. 2010 Jan 25;5(1):e8870.
Additional strain information