NBRP Rat No: 0883 |
Strain name: F344-Il2rgem1Iexas |
Commmon Name: X-SCID, F344-Il2rgem1Iexas |
Rat Genome Database |
Principal Investigator: |
Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan |
Tel: 03-6409-2489 Fax: |
Email: mashimo@ims.u-tokyo.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
albino |
Inbred Generations |
N3 |
Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
interleukin 2 receptor gamma (Il2rg) |
Origin |
【This strain is provided by the University of Tokyo (cooperative facility)】
This strain was established by CRISPR/Cas9 targeting rat Il2rg gene using electroporation.
background strain: F344/Jcl. gRNA: CCAACCTCACTATGCACTATAGG (PAM sequence: CCA). Cas9: mRNA transcripted from T7-NLS hCas9-pA (RDB13130). Off target analysis has not yet been conducted. |
Strain characteristics |
This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion of Il2rg gene. This strain grows normally under SPF condition. |
Breeding Conditions |
mating between hemizygous male and homozygous female rats |
Genotyping |
PCR: primers (TTGCTGACTTCTATGGACCTTAAA and TTCATCTGGTCTGAACTGATAACTTAT).
product size: wild 292 bp and mutant 287 bp |
References |
Mizuno-Iijima S, Kawamoto S, Asano M, Mashimo T, Wakana S, Nakamura K, Nishijima KI, Okamoto H, Saito K, Yoshina S, Miwa Y, Nakamura Y, Ohkuma M, Yoshiki A.
Mammalian genome research resources available from the National BioResource Project in Japan.
Mamm Genome. 2024 Dec;35(4):497-523.
Kim JI, Lim HJ, Kwon E, Mashimo T, Kang BC.
Immune deficiency phenotypes of Il2rg, Rag2 or Il2rg/Rag2 double knockout rats; establishment of human leukemia xenograft models.
Lab Anim Res. 2024 Dec 27;40(1):43.
Gima S, Oe K, Nishimura K, Ohgita T, Ito H, Kimura H, Saito H, Takata K.
Host-to-graft propagation of inoculated α-synuclein into transplanted human induced pluripotent stem cell-derived midbrain dopaminergic neurons.
Regen Ther. 2024 Jan 6:25:229-237.
Takeshi Tada, Hiroe Ohnishi, Norio Yamamoto, Fumihiko Kuwata, Yasuyuki Hayashi, Hideaki Okuyama, Tsunetaro Morino, Yoshiyuki Kasai, Hiromi Kojima, Koichi Omori
Transplantation of a human induced pluripotent stem cell-derived airway epithelial cell sheet into the middle ear of rats
Regen Ther. 2022 Jan 14:19:77-87.
Hayashi Y, Ohnishi H, Kitano M, Kishimoto Y, Takezawa T, Okuyama H, Yoshimatsu M, Kuwata F, Tada T, Mizuno K, Omori K.
Comparative study of immunodeficient rat strains in engraftment of hiPSC-derived airway epithelia.
Tissue Eng Part A. 2024 Feb;30(3-4):144-153.
Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T.
Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases.
PLoS One. 2010 Jan 25;5(1):e8870.
|
Additional strain information |
|
|
|