Strain information
 NBRP Rat No: 0895  Strain name: F344-Il2rgem1IexasRag2em1Iexas  Commmon Name: ダブルKO Rat Genome Database
Principal Investigator:  Tomoji Mashimo  The University of Tokyo, The Institute of Medical Science       4-6-1 Shirokanedai-Minatoku-Tokyoto    108-8639      Japan
Tel: 03-6409-2489    Fax:  Email: mashimo@ims.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  
Inbred Generations  N3
Usage Restrictions   The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected interleukin 2 receptor gamma (Il2rg), recombination activating 2(Rag2)
Origin 【This strain is provided by the University of Tokyo (cooperative facility)】This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. The off-target sites have not been identified yet.
Strain characteristics This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late.
Breeding Conditions Mating male hemizygous and female homozygous.
Genotyping Transgenic rats can be distinguished by PCR, electrophoresis and Sanger sequencing. Il2rg: Wiled type: 292 bp, Mutant: 287 bp, Primer：TTGCTGACTTCTATGGACCTTAAA, TTCATCTGGTCTGAACTGATAACTTAT, Rag2: Wilde type: 381bp, Mutant: 382bp, Primer：GGGGAGAAGGTGTCTTACGG, AGGTGGGAGGTAGCAGGAAT
References Joo-Il Kim, Mi-Young Park, Euna Kwon, Tomoji Mashimo, Hyoung Jin Kang, Byeong-Cheol Kang
Validation of a B cell acute lymphoblastic leukemia xenograft rat model for integrated efficacy, pharmacokinetics and safety of CD19 CAR-T
Toxicol Res. 2026 Mar 14.

Gospos J, Laubach M, Savi FM, Ravichandran A, Bauer J, Friedrich O, Holzapfel BM, Wagner F, Mashimo T, Saifzadeh S, Hutmacher DW, McGovern JA.
Dynamic asses　sment of a humanized bone tumour microenvironment reveals insights into osteosarcoma primary tumour remodelling and lung metastases.
Sci Rep. 2025 Nov 28;15(1):45619.

Kim JI, Lim HJ, Kwon E, Mashimo T, Kang BC.
Immune deficiency phenotypes of Il2rg, Rag2 or Il2rg/Rag2 double knockout rats; establishment of human leukemia xenograft models.
Lab Anim Res. 2024 Dec 27;40(1):43.

Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T. Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases. PLoS One. 2010 Jan 25;5(1):e8870.
Additional strain information