NBRP Rat No: 0895 |
Strain name: F344-Il2rgem1IexasRag2em1Iexas |
Commmon Name: ダブルKO |
Rat Genome Database |
Principal Investigator: |
Tomoji Mashimo The University of Tokyo, The Institute of Medical Science 4-6-1 Shirokanedai-Minatoku-Tokyoto 108-8639 Japan |
Tel: 03-6409-2489 Fax: |
Email: mashimo@ims.u-tokyo.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
|
Inbred Generations |
N3 |
Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
interleukin 2 receptor gamma (Il2rg), recombination activating 2(Rag2) |
Origin |
【This strain is provided by the University of Tokyo (cooperative facility)】This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. The off-target sites have not been identified yet. |
Strain characteristics |
This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late. |
Breeding Conditions |
Mating male hemizygous and female homozygous. |
Genotyping |
Transgenic rats can be distinguished by PCR, electrophoresis and Sanger sequencing. Il2rg: Wiled type: 292 bp, Mutant: 287 bp, Primer:TTGCTGACTTCTATGGACCTTAAA, TTCATCTGGTCTGAACTGATAACTTAT, Rag2: Wilde type: 381bp, Mutant: 382bp, Primer:GGGGAGAAGGTGTCTTACGG, AGGTGGGAGGTAGCAGGAAT |
References |
Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T. Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases. PLoS One. 2010 Jan 25;5(1):e8870. |
Additional strain information |
|
|