NBRP Rat No: 0893 |
Strain name: LE-Tg(Tac1-cre)6-7Koba |
Commmon Name: Tac1_Cre RecBAC 6-7ラット |
Rat Genome Database |
Principal Investigator: |
Kazuto Kobayashi Fukushima Medical University 1 Hikarigaoka Fukushima-shi 960-1295 Fukushima Japan |
Tel: 024-547-1667 Fax: 024-548-3936 |
Email: kazuto@fmu.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
白黒 |
Inbred Generations |
N6 (March 2018) |
Usage Restrictions |
The user requires a collaboration with the depositor. Consult with the depositor about details beforehand |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
cre: cre recombinase protein, Tac1: tachykinin, precursor (preprotachykinin-A) |
Origin |
Background strain: Long-Evans rat (Iar:Long-Evans). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs.
|
Strain characteristics |
This transgenic strain expresses Cre recombinase under the control of Tac1 promoter.
Cre recombinase expression is higher among lines in the order 4-1, 6-7, and 3-2. |
Breeding Conditions |
Maintained by mating heterozygous rats with Long-Evans rats. Good breeding performance. |
Genotyping |
Identification of cre sequence by PCR.
Primers F:TCGATGCAACGAGTGATGAG, R:TTCGGCTATACGTAACAGGG
PCR condition (TaKaRa Taq): 94℃ 5min ↓ 94℃ (30cycle) 20s 56℃ 30s 72℃ 30s 4℃ ↓
Product size:482 bp |
References |
Monitoring and Updating of Action Selection for Goal-Directed Behavior through the Striatal Direct and Indirect Pathways.
Nonomura S, Nishizawa K, Sakai Y, Kawaguchi Y, Kato S, Uchigashima M, Watanabe M, Yamanaka K, Enomoto K, Chiken S, Sano H, Soma S, Yoshida J, Samejima K, Ogawa M, Kobayashi K, Nambu A, Isomura Y, Kimura M.
Neuron. 2018 Sep 19;99(6):1302-1314.e5. doi: 10.1016/j.neuron.2018.08.002. Epub 2018 Aug 23. |
Additional strain information |
|
|