Strain information
 NBRP Rat No: 0893  Strain name: LE-Tg(Tac1-cre)6-7Koba  Commmon Name: Tac1_Cre RecBAC 6-7ラット Rat Genome Database
Principal Investigator:  Kazuto Kobayashi  Fukushima Medical University       1 Hikarigaoka Fukushima-shi    960-1295 Fukushima     Japan
Tel: 024-547-1667    Fax: 024-548-3936 Email: kazuto@fmu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白黒
Inbred Generations  N6 (March 2018)
Usage Restrictions  The user requires a collaboration with the depositor. Consult with the depositor about details beforehand
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 神経科学一般
 Control Strain  Marker Strain
Gene Affected cre: cre recombinase protein, Tac1: tachykinin, precursor (preprotachykinin-A)
Origin Background strain: Long-Evans rat (Iar:Long-Evans). This strain was established by injection of modified BAC (cre gene was inserted into the exon 2 of rat Tac1 gene) into Long-Evans rat's fertile eggs.
Strain characteristics This transgenic strain expresses Cre recombinase under the control of Tac1 promoter. Cre recombinase expression is higher among lines in the order 4-1, 6-7, and 3-2.
Breeding Conditions Maintained by mating heterozygous rats with Long-Evans rats. Good breeding performance.
Genotyping Identification of cre sequence by PCR. Primers F:TCGATGCAACGAGTGATGAG, R:TTCGGCTATACGTAACAGGG PCR condition (TaKaRa Taq): 94℃ 5min ↓ 94℃ (30cycle) 20s 56℃ 30s 72℃ 30s 4℃ ↓ Product size:482 bp
References Monitoring and Updating of Action Selection for Goal-Directed Behavior through the Striatal Direct and Indirect Pathways.
Nonomura S, Nishizawa K, Sakai Y, Kawaguchi Y, Kato S, Uchigashima M, Watanabe M, Yamanaka K, Enomoto K, Chiken S, Sano H, Soma S, Yoshida J, Samejima K, Ogawa M, Kobayashi K, Nambu A, Isomura Y, Kimura M.
Neuron. 2018 Sep 19;99(6):1302-1314.e5. doi: 10.1016/j.neuron.2018.08.002. Epub 2018 Aug 23.
Additional strain information