| NBRP Rat No: 0821 |
Strain name: F344-Hcn1em1Kyo |
Commmon Name: Hcn1 KO (Line84) , F344-Hcn1em84Kyo |
Rat Genome Database |
| Principal Investigator: |
Takashi Kuramoto Tokyo University of Agriculture 1737 Funako, Atsugi, 243-0034 Kanagawa Japan |
| Tel: 046-270-6583 Fax: 046-270-6585 |
Email: tk206782@nodai.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白色 |
| Inbred Generations |
|
| Usage Restrictions |
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) |
| Origin |
TALEN (Left:ttcagAATGATTCATGGG, Right:ACGCACTCTTCAAAGCTA)targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo. |
| Strain characteristics |
A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein. |
| Breeding Conditions |
maintained by crossing between homozygous and homozygous, or homozygous and heterozygous rats |
| Genotyping |
rHcn1-e4-KO-F:ttccaaccatttgcctacaa
rHcn1-e4-KO-R:gccataaccaatgcacagc
PRODUCT SIZE:wild 239, KO 232
|
| References |
Nishitani A, Nagayoshi H, Takenaka S, Asano M, Shimizu S, Ohno Y, Kuramoto T.
Involvement of NMDA receptors in tremor expression in Aspa/Hcn1 double-knockout rats.
Exp Anim. 2020 Nov 12;69(4):388-394.
Nishitani A, Yoshihara T, Tanaka M, Kuwamura M, Asano M, Tsubota Y, Kuramoto T.
Muscle weakness and impaired motor coordination in hyperpolarization-activated cyclic nucleotide-gated potassium channel 1-deficient rats.
Exp Anim. 2020 Jan 29;69(1):11-17.
Nishitani A, Kunisawa N, Sugimura T, Sato K, Yoshida Y, Suzuki T, Sakuma T, Yamamoto T, Asano M, Saito Y, Ohno Y, Kuramoto T.
Loss of HCN1 subunits causes absence epilepsy in rats.
Brain Res. 2019 Mar 1:1706:209-217. |
| Additional strain information |
|
|