Strain information
 NBRP Rat No: 0821  Strain name: F344-Hcn1em1Kyo  Commmon Name: Hcn1 KO (Line84) , F344-Hcn1em84Kyo Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Graduate School of Medicine, Kyoto University       Yoshidakonoe-cho, Sakyo-ku    606-8501 Kyoto     Japan
Tel: 075-753-4494    Fax: 075-753-4409 Email: kuramot@anim.med.kyoto-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白色
Inbred Generations  
Usage Restrictions   The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1)
Origin TALEN (Left:ttcagAATGATTCATGGG, Right:ACGCACTCTTCAAAGCTA)targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo.
Strain characteristics A 7-bp deletion in the exon4 of Hcn1 gene: as a result of frameshift mutation, stop codon is produced. Decreased expression levels of Hcn1 gene and HCN1 protein.
Breeding Conditions maintained by crossing between homozygous and homozygous, or homozygous and heterozygous rats
Genotyping rHcn1-e4-KO-F:ttccaaccatttgcctacaa rHcn1-e4-KO-R:gccataaccaatgcacagc PRODUCT SIZE:wild 239, KO 232
References Nishitani A, Nagayoshi H, Takenaka S, Asano M, Shimizu S, Ohno Y, Kuramoto T.
Involvement of NMDA receptors in tremor expression in Aspa/Hcn1 double-knockout rats.
Exp Anim. 2020 Nov 12;69(4):388-394.

Nishitani A, Yoshihara T, Tanaka M, Kuwamura M, Asano M, Tsubota Y, Kuramoto T.
Muscle weakness and impaired motor coordination in hyperpolarization-activated cyclic nucleotide-gated potassium channel 1-deficient rats.
Exp Anim. 2020 Jan 29;69(1):11-17.

Nishitani A, Kunisawa N, Sugimura T, Sato K, Yoshida Y, Suzuki T, Sakuma T, Yamamoto T, Asano M, Saito Y, Ohno Y, Kuramoto T.
Loss of HCN1 subunits causes absence epilepsy in rats.
Brain Res. 2019 Mar 1:1706:209-217.
Additional strain information