Strain information
 NBRP Rat No: 0822  Strain name: F344-Hcn1em4Kyo  Commmon Name: Hcn1 KO (Line89), F344-Hcn1em89Kyo Rat Genome Database
Principal Investigator:  Takashi Kuramoto  Tokyo University of Agriculture       1737 Funako, Atsugi,    243-0034 Kanagawa     Japan
Tel: 046-270-6583    Fax: 046-270-6585 Email: tk206782@nodai.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白色
Inbred Generations  
Usage Restrictions   The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
For a commercial use of this resource, a new contract must be concluded between the depositor and the recipient.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1)
Origin TALEN (Left:ttcagAATGATTCATGGG, Right:ACGCACTCTTCAAAGCTA)targeting the exon4 of hyperpolarization-activated cyclic nucleotide-gated 1 channel (Hcn1) gene was designed and mRNA coding these TALEN was microinjected into F344/NSlc embyo.
Strain characteristics A 18-bp deletion in the exon4 of Hcn1 gene. It is predicted that 6 amino-acid deleted HCN1 protein is expressed.
Breeding Conditions maintained by crossing between homozygous and homozygous, or homozygous and heterozygous rats
Genotyping rHcn1-e4-KO-F:ttccaaccatttgcctacaa rHcn1-e4-KO-R:gccataaccaatgcacagc PRODUCT SIZE:wild 239, KO 221
References
Additional strain information