NBRP Rat No: 0877 |
Strain name: W-Tg(Slc32a1-cre)5_9Fusa |
Commmon Name: VGAT-Cre-BACTg5_9 |
Rat Genome Database |
Principal Investigator: |
Fusao Kato Jikei University School of Medicine 3-25-8, Nishi-Shimbashi, Minato-ku,Tokyo 105-8461 Tokyo Japan |
Tel: 03-3433-1111(ext.2396) Fax: 03-5400-1231 |
Email: fusao@jikei.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
 |
 |
Coat Color |
|
Inbred Generations |
F2, F3 |
Usage Restrictions |
1. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgement to hte DEPOSITOR is requested. 2. The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. 1)RECIPIENT should use this resource only for fundamental biomedical research and educational purposes 2) RECIPIENT should recognize that there would remain unidentified specificities of this resource and therefore he/she uses this resource with appropriate care and prudence. 3) RECIPIENT agrees that this resource should never be used for human studies including the diagnostic purposes. 4) RECIPIENT agrees to contact and consult the DEPOSITOR in advance in cases in which RECIPIENT discloses the research results using this resource in academic journals. 5) RECIPIENT should not transfer this resource without written consent of the DEPOSITOR. 6) RECIPIENT should not use this resource for commercial purposes of any kind. 7) RECIPIENT agrees to acknowledge the following in any publications, oral or written, reporting use of it as related to the MATERIAL: "The W-Tg(Slc32a1-cre)3_5Fusa rat was developed by Drs. F. Kato and A. M. Watabe (Jikei University) with a support from the C.B.S.N project conducted by Drs. K. Kobayashi (Fukushima Medical University) and Y. Yanagawa (Gumma University), using a VGAT-Cre BAC construct developed by Dr. S. Itohara (RIKEN)." 8) RECIPIENT agrees to provide a copy of the publication containing results using this resource to the followings: Dr. Fusao Kato (fusao@jikei.ac.jp) Dr. Yuchio Yanagawa (yuchio@gunma-u.ac.jp) Dr. Shigeyoshi Itohara (sitohara@brain.riken.jp) |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Slc32a1 (solute carrier family 32 (GABA vesicular transporter), member 1) promoter, cre |
Origin |
Tihs strain was established by Bac transgenic method (construct: Kazuhiro Yamakawa, phD) supported by C.B.S.Nresource (Dr. Kazuto Kobayashi, Dr. Yuchio Yanagawa) in 2014 and maintaied at Jikei University School of Medicine. Background: Crlj:WI. Transgene: VGAT(Slc32a1: mouse, Kanamycin registance gene(E. coli), Cre(P1 phage), polyA signal(SV40 virus. Clonindg vector:pBACe3.6, Mouse BAC clone: RP23-392-P11 |
Strain characteristics |
Cre recombinase is expressed under the control of mouse Slc32a1 (VGAT) promoter. This strain is used for GABAergic neuron-specific Cre-Lox site-specific recombination system. |
Breeding Conditions |
Maintained in heterozygous condition (mating with Wistar rats) |
Genotyping |
Primers…Cre-F: GCAGAACCTGAAGATGTTCGCGAT, Cre-R: AGGTATCTCTGACCAGAGTCATCC.
Reaction mixture…Milli Q up to 10 µl・10x Ex buffer 1 µl・dNTP 1 µl・Primer Cre-F (10 pmol/ul) 0.2 µl・Primer Cre-R (10 pmol/ul) 0.2 µl・DNA 0.5 µl・Ex Taq Hot start (TAKARA) 0.075 µl/Total 10 µl
Program: 95°C, 3 min; (95°C, 30 sec; 60°C, 30 sec; 72°C, 1 min) x 35; 72°C, 7 min; 10°C, pause
Product: Cre; 656 bp |
References |
別ライン「W-Tg(Slc32a1-cre)3_5Fusa (NBRP Rat No. 0839)」のみ
Soma S, Yoshida J, Kato S, Takahashi Y, Nonomura S, Sugimura YK, Ríos A,
Kawabata M, Kobayashi K, Kato F, Sakai Y, Isomura Y. Ipsilateral-Dominant Control
of Limb Movements in Rodent Posterior Parietal Cortex. J Neurosci. 2019 Jan
16;39(3):485-502. |
Additional strain information |
|
|