| NBRP Rat No: 0903 |
Strain name: W-Trpa1em1Kcrd |
Commmon Name: TRPA1KOrat |
Rat Genome Database |
| Principal Investigator: |
Kazuaki Ohara Kirin Company,Limited 1-13-5 fukuura-kanazawaku, 236-0004 |
| Tel: 080-2196-6648 Fax: 045-788-4042 |
Email: Kazuaki_Ohara@kirin.co.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白色 |
| Inbred Generations |
F6 |
| Usage Restrictions |
In publishing, the reserach results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Ohara et al.,"B-Eudesmol, an oxygenized sesquiterpene, stimulates appetite via TRPA1 and the autonomic nervous system." Scirep. 2017 Nov 17; 7(1):15785 The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. The availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for profit organization for a not-for-profit research. RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use besed on the results from the use of the BIOLOGICAL RESOURCE. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
TRPA1 |
| Origin |
Trpa1-deleted Wistar (Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted. |
| Strain characteristics |
Noticeable phenotype is not observed under normal breeding. Intracellular calcium elevation treated by TRPA1-activating agent is not occurred under the calcium imaging using dorsal root ganglion neurons. |
| Breeding Conditions |
Good breeding. |
| Genotyping |
Determine by genomic PCR. Primer: Mt-F; CCTGATTTGCTCTGGCACA, Int24CellF; TGGGACTGTGTGGTGCT, Int24IgdelR; CCACAGTTCACCACCTTTCA PCR enzyme:KOD FX (Toyobo) Component Volume: template 1.0 μl Mt-F (10 μM) 0.75 μl Int24 lgdel R (10 μM) 0.75 μl Int24 Cel1 F (10 μM) 0.75 μl 2 x FX buffer 12.5 μl 2.0 mM dNTPs each 5.0 μl KOD FX 0.5 μl ddw 3.75 μl Total 25.0 μl Cycling condition (35 cycles): Predenature : 94.0 ℃ 2 min. Denature : 98.0 ℃ 10 sec. Annealing : 62.5 ℃ 30 sec. Extention : 68.0 ℃ 30 sec. Final extension : 68.0 ℃ 30 sec. Hold : 4.0 ℃ Size of PCR products: Mutant 300bp Wild 563 bp |
| References |
β-Eudesmol, an oxygenized sesquiterpene, stimulates appetite via TRPA1 and the autonomic nervous system.
Ohara K, Fukuda T, Ishida Y, Takahashi C, Ohya R, Katayama M, Uchida K, Tominaga M, Nagai K.
Sci Rep. 2017 Nov 17;7(1):15785. doi: 10.1038/s41598-017-16150-6. |
| Additional strain information |
|
|