Strain information
 NBRP Rat No: 0903  Strain name: W-Trpa1em1Kcrd  Commmon Name: TRPA1KOrat Rat Genome Database
Principal Investigator:  Kazuaki Ohara  Kirin Company,Limited       1-13-5 fukuura-kanazawaku,    236-0004     
Tel: 080-2196-6648    Fax: 045-788-4042 Email: Kazuaki_Ohara@kirin.co.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白色
Inbred Generations  F6
Usage Restrictions  In publishing, the reserach results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Ohara et al.,"B-Eudesmol, an oxygenized sesquiterpene, stimulates appetite via TRPA1 and the autonomic nervous system." Scirep. 2017 Nov 17; 7(1):15785
The recipient of BIOLOGICAL RESOURCE shall obtain a prior
written consent on use of it from the DEPOSITOR.
The availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for profit organization for a not-for-profit research.
RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use besed on the results from the use of the BIOLOGICAL RESOURCE.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected TRPA1
Origin Trpa1-deleted Wistar (Crl:WI) strain was generated by using Zinc Finger Nuclease at Kirin Company, Limited in 2013. Exon 22-24, which form ion channel pore required for the activation in Trpa1 gene, was deleted.
Strain characteristics Noticeable phenotype is not observed under normal breeding. Intracellular calcium elevation treated by TRPA1-activating agent is not occurred under the calcium imaging using dorsal root ganglion neurons.
Breeding Conditions Good breeding.
Genotyping Determine by genomic PCR. Primer: Mt-F; CCTGATTTGCTCTGGCACA, Int24CellF; TGGGACTGTGTGGTGCT, Int24IgdelR; CCACAGTTCACCACCTTTCA PCR enzyme:KOD FX (Toyobo) Component Volume: template 1.0 μl Mt-F (10 μM) 0.75 μl Int24 lgdel R (10 μM) 0.75 μl Int24 Cel1 F (10 μM) 0.75 μl 2 x FX buffer 12.5 μl 2.0 mM dNTPs each 5.0 μl KOD FX 0.5 μl ddw 3.75 μl Total 25.0 μl Cycling condition (35 cycles): Predenature : 94.0 ℃ 2 min. Denature : 98.0 ℃ 10 sec. Annealing : 62.5 ℃ 30 sec. Extention : 68.0 ℃ 30 sec. Final extension : 68.0 ℃ 30 sec. Hold : 4.0 ℃ Size of PCR products: Mutant 300bp Wild 563 bp
References Nakatomi C, Hitomi S, Yamaguchi K, Hsu CC, Seta Y, Harano N, Iwata K, Ono K.
Cisplatin induces TRPA1-mediated mechanical allodynia in the oral mucosa.
Arch Oral Biol. 2022 Jan;133:105317. doi: 10.1016/j.archoralbio.2021.105317.

β-Eudesmol, an oxygenized sesquiterpene, stimulates appetite via TRPA1 and the autonomic nervous system.
Ohara K, Fukuda T, Ishida Y, Takahashi C, Ohya R, Katayama M, Uchida K, Tominaga M, Nagai K.
Sci Rep. 2017 Nov 17;7(1):15785. doi: 10.1038/s41598-017-16150-6.
Additional strain information