NBRP Rat No: 0915 |
Strain name: WIC-Sparcem1Kykn |
Commmon Name: SPARC KO |
Rat Genome Database |
Principal Investigator: |
Keitaro Yamanouchi The University of Tokyo 1-1-1, Yayoi, Bunkyo-ku, 113-8657 Tokyo Japan |
Tel: 03-5841-5387 Fax: 03-5841-8017 |
Email: akeita@mail.ecc.u-tokyo.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
白色 |
Inbred Generations |
|
Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Secreted Protein Acidic and Rich in Cysteine (SPARC) |
Origin |
By CRISPR/Cas9 system, mutation was introduced in SPARC gene of Wistar-Imamichi rat (Iar: Wistar-Imamichi, Institute for Animal Reproduction). |
Strain characteristics |
By CRISPR/Cas9 system, mutation was introduced in SPARC gene of Wistar-Imamichi rat. 7 bp deletion around Exon7. |
Breeding Conditions |
Natural mating |
Genotyping |
Primer sequence Forward: ggaagagtctggatcagagagacag Reverse: gcttaaggagaaggcctgttaactc
1st PCR 94℃ 2 min, 98℃ 10s 60℃ 30s 68℃ 1 min 36 cycles.
In the case of WT or KO (homo), one DNA band is observed around 500 bp. In the case of, KO (hetero), two DNA bands are observed around 500 bp. To distinguish between WT and KO (homo), add WT genome into all PCR samples, and run PCR again. In the case of WT, one DNA band is observed around 500 bp. In the case of KO (homo), two DNA band are observed around 500 bp.
|
References |
|
Additional strain information |
|
|