Strain information
 NBRP Rat No: 0915  Strain name: WIC-Sparcem1Kykn  Commmon Name: SPARC KO Rat Genome Database
Principal Investigator:  Keitaro Yamanouchi  The University of Tokyo        1-1-1, Yayoi, Bunkyo-ku,    113-8657 Tokyo     Japan
Tel: 03-5841-5386    Fax: 03-5841-8017 Email: akeita@g.ecc.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白色
Inbred Generations  
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 筋病理学
 Control Strain  Marker Strain
Gene Affected Secreted Protein Acidic and Rich in Cysteine (SPARC)
Origin By CRISPR/Cas9 system, mutation was introduced in SPARC gene of Wistar-Imamichi rat (Iar: Wistar-Imamichi, Institute for Animal Reproduction).
Strain characteristics By CRISPR/Cas9 system, mutation was introduced in SPARC gene of Wistar-Imamichi rat. 7 bp deletion around Exon7.
Breeding Conditions Natural mating
Genotyping Primer sequence Forward: ggaagagtctggatcagagagacag Reverse: gcttaaggagaaggcctgttaactc
1st PCR 94℃ 2 min, 98℃ 10s 60℃ 30s 68℃ 1 min 36 cycles.
In the case of WT or KO (homo), one DNA band is observed around 500 bp. In the case of, KO (hetero), two DNA bands are observed around 500 bp. To distinguish between WT and KO (homo), add WT genome into all PCR samples, and run PCR again. In the case of WT, one DNA band is observed around 500 bp. In the case of KO (homo), two DNA band are observed around 500 bp.
References
Additional strain information