Strain information  NBRP Rat No: 0915  Strain name: WIC-Sparcem1Kykn  Commmon Name: SPARC KO Rat Genome Database Principal Investigator:  Keitaro Yamanouchi  The University of Tokyo        1-1-1, Yayoi, Bunkyo-ku,    113-8657 Tokyo     Japan Tel: 03-5841-5386    Fax: 03-5841-8017 Email: akeita@g.ecc.u-tokyo.ac.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color  白色 Inbred Generations   Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others 筋病理学  Control Strain  Marker Strain Gene Affected Secreted Protein Acidic and Rich in Cysteine (SPARC) Origin By CRISPR/Cas9 system, mutation was introduced in SPARC gene of Wistar-Imamichi rat (Iar: Wistar-Imamichi, Institute for Animal Reproduction). Strain characteristics By CRISPR/Cas9 system, mutation was introduced in SPARC gene of Wistar-Imamichi rat. 7 bp deletion around Exon7. Breeding Conditions Natural mating Genotyping Primer sequence Forward: ggaagagtctggatcagagagacag Reverse: gcttaaggagaaggcctgttaactc 1st PCR 94℃ 2 min, 98℃ 10s 60℃ 30s 68℃ 1 min 36 cycles. In the case of WT or KO (homo), one DNA band is observed around 500 bp. In the case of, KO (hetero), two DNA bands are observed around 500 bp. To distinguish between WT and KO (homo), add WT genome into all PCR samples, and run PCR again. In the case of WT, one DNA band is observed around 500 bp. In the case of KO (homo), two DNA band are observed around 500 bp. References Additional strain information