Strain information  NBRP Rat No: 0917  Strain name: SHRSP-Stim1em1Izm  Commmon Name: SHRSP Stim1 KI Rat Genome Database Principal Investigator:  Tohru Nabika  Shimane University, School of Medicine       89-1 Enya-cho, Izumo    693-8901 Shimane     Japan Tel: 0853-20-2136    Fax: 0853-20-2135 Email: nabika@med.shimane-u.ac.jp Preservation Status:   Embryo        Sperm       Living Animals Coat Color  white Inbred Generations   Usage Restrictions  The following terms and conditions are requested by the DEPOSITOR. Recipients are requested to obtain a written approval of the depositor. Genetic Status   Inbred  Segregating   Congenic   Consomic   Recombinant   Coisogenic   Spont. Mutant  Transgene  Ind. Mutant  Category Other  Comercial Availability Research Category   Diabetes Obesity  Neurobiology  Ophthalmology   Dentistry  Cardio Hypertension  Cancer  Metabolism  Otorhinology  Immunology  Infectious  Osteosis   Internal Organ  Dermatology   Reproduction   Development  Behavior  Hematology  Urology   Pharmacology  Research Area Others   Control Strain  Marker Strain Gene Affected Stim1: Stromal interaction molecule 1（Rattus norvegicus） Origin This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence. The sequence of the guide RNA target site is as follows, Stim1: 5'-GCAGGGTAGCTGAAACACAC-3' The sequence of the ssODN for homologous recombination is as follows, 5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3' Strain characteristics The blood pressure is equivalent to SHRSP/Izm. Breeding Conditions Maintain by sibling mating between homozygous rats. Breeding performance is good. Genotyping This strain can be determined by PCR using primers designed to the target mutant site or by sequencing of genomic DNA. The PCR primers used by the depositor are as follows, F: GGCGCTGAACCATGGCCTAGATAAG R (for wild type): CCAGCCAAGTGGGGAATTCGTGTGTTTAG R (for mutants): CCAGCCAAGTGGGGAATTCGTGTGTTTAA References Odongoo B, Ohara H, Ngarashi D, Kaneko T, Kunihiro Y, Mashimo T, Nabika T. Pathophysiological significance of Stim1 mutation in sympathetic response to stress and cardiovascular phenotypes in SHRSP/Izm: In vivo evaluation by creation of a novel gene knock-in rat using CRISPR/Cas9. Clin Exp Hypertens. 2020 Jul 23:1-8. Additional strain information