NBRP Rat No: 0917 |
Strain name: SHRSP-Stim1em1Izm |
Commmon Name: SHRSP Stim1 KI |
Rat Genome Database |
Principal Investigator: |
Tohru Nabika Shimane University, School of Medicine 89-1 Enya-cho, Izumo 693-8901 Shimane Japan |
Tel: 0853-20-2136 Fax: 0853-20-2135 |
Email: nabika@med.shimane-u.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
white |
Inbred Generations |
|
Usage Restrictions |
The following terms and conditions are requested by the DEPOSITOR. Recipients are requested to obtain a written approval of the depositor. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Stim1: Stromal interaction molecule 1(Rattus norvegicus) |
Origin |
This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence.
The sequence of the guide RNA target site is as follows,
Stim1: 5'-GCAGGGTAGCTGAAACACAC-3'
The sequence of the ssODN for homologous recombination is as follows,
5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'
|
Strain characteristics |
The blood pressure is equivalent to SHRSP/Izm. |
Breeding Conditions |
Maintain by sibling mating between homozygous rats. Breeding performance is good. |
Genotyping |
This strain can be determined by PCR using primers designed to the target mutant site or by sequencing of genomic DNA.
The PCR primers used by the depositor are as follows,
F: GGCGCTGAACCATGGCCTAGATAAG
R (for wild type): CCAGCCAAGTGGGGAATTCGTGTGTTTAG
R (for mutants): CCAGCCAAGTGGGGAATTCGTGTGTTTAA
|
References |
Odongoo B, Ohara H, Ngarashi D, Kaneko T, Kunihiro Y, Mashimo T, Nabika T.
Pathophysiological significance of Stim1 mutation in sympathetic response to stress and cardiovascular phenotypes in SHRSP/Izm: In vivo evaluation by creation of a novel gene knock-in rat using CRISPR/Cas9.
Clin Exp Hypertens. 2020 Jul 23:1-8. |
Additional strain information |
|
|