Strain information
 NBRP Rat No: 0881  Strain name: F344-Angptl8em1Kyo  Commmon Name: AKO rat, Angptl8 KO rat (line No. 1) Rat Genome Database
Principal Investigator:  Kazuwa　Nakao  Kyoto University Graduate School of Medicine        53 Shogoin-Kawahara-chou, Sakyo-ku    606-8507 Kyoto city     Japan
Tel: 075-366-7450    Fax: 075-752-7140 Email: nakao@kuhp.kyoto-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  
Usage Restrictions  In publishing the serearch results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.

In publishing, an acknowledgment to the DEPOSITOR is requested.
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
Disclosure of experimental protocol is requested by thr DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Angptl8
Origin This Angptl8 KO strain has been established by CRISPR/Cas9 system at Kyoto University in 2014. Background strain: F344/Stm, gRNA target sequence: CCACAGCCCGATCGCTGAGGGAA, CCACGTGCAGCGACAGCAGCGTG, and PAM sequence: CCA. Mutaion: 7-bp deletion in the exon2 of Angptl8 gene. No Off Target effects are observed.
Strain characteristics Blood TG concentration (fasting and casual) falls to one-thirds to one-half. 2 lines are deposited, but there are no obvious differences in phenotypes between both lines (June, 2017).
Breeding Conditions Mating between heterozygous rats. KO rats have fertility.
Genotyping Check the product size by PCR. Primers are F : CATCTGTTGAGCAGGCAGAA　R : GTTGAGTGGTGGCTTCCTTC. PCR condition is 94℃ 3 min, (94℃　30 sec, 60℃ 1 min, 72℃ 2 min）x 45 cycles and 72℃ 3 min. Product sizes are 232 bp (WT) and 225 bp (KO).
References CRISPR/Cas9-mediated Angptl8 knockout suppresses plasma triglyceride concentrations and adiposity in rats.
Izumi R, Kusakabe T, Noguchi M, Iwakura H, Tanaka T, Miyazawa T, Aotani D, Hosoda K, Kangawa K, Nakao K.
J Lipid Res. 2018 Sep;59(9):1575-1585.
Additional strain information