NBRP Rat No: 0874 |
Strain name: F344-Angptl8em2Kyo |
Commmon Name: AKO rat, Angptl8 KO rat (line No. 2) |
Rat Genome Database |
Principal Investigator: |
Kazuwa Nakao Kyoto University Graduate School of Medicine 53 Shogoin-Kawahara-chou, Sakyo-ku 606-8507 Kyoto city Japan |
Tel: 075-366-7450 Fax: 075-752-7140 |
Email: nakao@kuhp.kyoto-u.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
|
|
Coat Color |
白 |
Inbred Generations |
|
Usage Restrictions |
In publishing the serearch results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
In publishing, an acknowledgment to the DEPOSITOR is requested. The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. Disclosure of experimental protocol is requested by thr DEPOSITOR. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Angptl8: angiopoietin-like 8 (betatrophin) |
Origin |
This Angptl8 KO strain has been established by CRISPR/Cas9 system at Kyoto University in 2014. Background strain: F344/Stm, gRNA target sequence: CCACAGCCCGATCGCTGAGGGAA, CCACGTGCAGCGACAGCAGCGTG, and PAM sequence: CCA. Mutaion: 980-bp deletion in the exon2 of Angptl8 gene. No Off Target effects are observed. |
Strain characteristics |
Blood TG concentration (fasting and casual) falls to one-thirds to one-half. 2 lines are deposited, but there are no obvious differences in phenotypes between both lines (June, 2017). |
Breeding Conditions |
Mating between heterozygous rats. KO rats have fertility. |
Genotyping |
Check the product size by PCR. Primers are F : GGGTGAGCAAAGCTGACCTA and R : GAGTAAACCCACCAGGCTCA. PCR condition is 94℃ 3 min, (94℃ 30 sec, 60℃ 1 min, 72℃ 2 min)x 45 cycles and 72℃ 3 min. Product sizes are 1,252 bp (WT) and 225 bp (KO). |
References |
CRISPR/Cas9-mediated Angptl8 knockout suppresses plasma triglyceride concentrations and adiposity in rats.
Izumi R, Kusakabe T, Noguchi M, Iwakura H, Tanaka T, Miyazawa T, Aotani D, Hosoda K, Kangawa K, Nakao K.
J Lipid Res. 2018 Sep;59(9):1575-1585. |
Additional strain information |
|
|