| NBRP Rat No: 0934 |
Strain name: LE-Tg(Drd2-IL2RA/YFP*)1Koba |
Commmon Name: Drd2-IL2Rラット |
Rat Genome Database |
| Principal Investigator: |
Kazuto Kobayashi Fukushima Medical University 1 Hikarigaoka Fukushima-shi 960-1295 Fukushima Japan |
| Tel: 024-547-1667 Fax: 024-548-3936 |
Email: kazuto@fmu.ac.jp |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白黒 |
| Inbred Generations |
F13 (Oct. 2020) |
| Usage Restrictions |
The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. The user requires a collaboration with the DEPOSITOR. Cousult with the DEPOSITOR about details beforehand. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
IL2R alpha-subunit, Drd2 |
| Origin |
Background strain: Iar:LE (Institute for Animal Reproduction)
This strain was generated by injecting a modified BAC, in which a fusion protein created from the IL2R alpha-subunit gene and YFP was inserted into the second exon of the rat Drd2 gene, into fertilized eggs of Long-Evans rats. |
| Strain characteristics |
Transgenic rats expressing a fusion protein created from the IL2R alpha-subunit and YFP under the control of the Drd2 gene. |
| Breeding Conditions |
Good breerding performance.
Heterozygous transgenic rats are crossed with wild-type Long-Evans rats. |
| Genotyping |
Identification of IL2R sequence by PCR.
Primers: Forward (ATGGATTCATACCTGCTGAT), Reverse (GCTACCTGGTACTCTGTTGT)
PCR condition: TaKaRa Taq, 94℃ 5 min, 94℃ (30 cycle) 20 sec, 56℃ 30 sec, 72℃ 30 sec, 4℃
Product size: 724 bp |
| References |
Striatal Indirect pathway contributes to selection accuracy of learned motor actions. Nishizawa K, Fukabori R, Okada K, Kai N,Uchigashima M, Watanabe M, Shiota A, Ueda M, Tsutsui Y, Kobayashi K. J Neurosci. 32(39): 13421-13432 (2012). |
| Additional strain information |
|
|