Strain information
 NBRP Rat No: 0934  Strain name: LE-Tg(Drd2-IL2RA/YFP*)1Koba  Commmon Name: Drd2-IL2Rラット Rat Genome Database
Principal Investigator:  Kazuto Kobayashi  Fukushima Medical University       1 Hikarigaoka Fukushima-shi    960-1295 Fukushima     Japan
Tel: 024-547-1667    Fax: 024-548-3936 Email: kazuto@fmu.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白黒
Inbred Generations  F13 (Oct. 2020)
Usage Restrictions  The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent
on use of it from the DEPOSITOR.
The user requires a collaboration with the DEPOSITOR. Cousult with the DEPOSITOR about details beforehand.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 神経科学一般
 Control Strain  Marker Strain
Gene Affected IL2R alpha-subunit, Drd2
Origin Background strain: Iar:LE (Institute for Animal Reproduction) This strain was generated by injecting a modified BAC, in which a fusion protein created from the IL2R alpha-subunit gene and YFP was inserted into the second exon of the rat Drd2 gene, into fertilized eggs of Long-Evans rats.
Strain characteristics Transgenic rats expressing a fusion protein created from the IL2R alpha-subunit and YFP under the control of the Drd2 gene.
Breeding Conditions Good breerding performance. Heterozygous transgenic rats are crossed with wild-type Long-Evans rats.
Genotyping Identification of IL2R sequence by PCR. Primers: Forward (ATGGATTCATACCTGCTGAT), Reverse (GCTACCTGGTACTCTGTTGT) PCR condition: TaKaRa Taq, 94℃ 5 min, 94℃ (30 cycle) 20 sec, 56℃ 30 sec, 72℃ 30 sec, 4℃ Product size: 724 bp
References Striatal Indirect pathway contributes to selection accuracy of learned motor actions. Nishizawa K, Fukabori R, Okada K, Kai N,Uchigashima M, Watanabe M, Shiota A, Ueda M, Tsutsui Y, Kobayashi K. J Neurosci. 32(39): 13421-13432 (2012).
Additional strain information