Strain information
 NBRP Rat No: 0938  Strain name: WIC-Cdkn2aem1Kyhs  Commmon Name: p16欠損ラット Rat Genome Database
Principal Investigator:  Keitaro Yamanouchi  The University of Tokyo        1-1-1, Yayoi, Bunkyo-ku,    113-8657 Tokyo     Japan
Tel: 03-5841-5386    Fax: 03-5841-8017 Email: akeita@g.ecc.u-tokyo.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  6
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Cellular senescence-mediated exacerbation of Duchenne muscular dystrophy.
Sugihara H,Teramoto N, Nakamura K, Shiga T, Shirakawa T, Matsuo M, Ogasawara M, Nishino I,Matsuwaki T, Nishihara M, Yamanouchi K.
Sd Rep.2020 Oct 12;10(1):16385. doi:10.1038/s41598-020-73315-6.
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE,an acknowledgment to the DEPOSITOR is requested.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 筋再生、老化
 Control Strain  Marker Strain
Gene Affected p16Cdkn2a
Origin A 7-bp deletion in exon 1 of the Cdkn2a (p16) gene was introduced by the CRISPR/Cas9. Genetic background is Iar:Wistar-Imamichi (Institute for Animal Reproduction).
Strain characteristics Introducing the deletion mutation in the Cdkn2a (p16) gene into the background of DMD rats (muscular dystrophy model rats) improves muscle pathology.
Breeding Conditions Maintained by natural mating of heterozygous females and males.
Genotyping Genotyping by PCR. Primer F: CACTGAATCTCCGAGAGGAAGG, Primer R: ATTACCTGGGGTATACATTTCATGC. PCR conditions: Using KOD FX Neo. 94℃ 5 min, x 1 cycle 98℃ 10 sec, 58℃ 30 sec, 68℃ 40 sec x 38 cycles. To analyze the size of DNA samples, use the Microchip Electrophoresis System for DNA/RNA Analysis (MultiNA).
References Cellular senescence-mediated exacerbation of Duchenne muscular dystrophy.
Sugihara H, Teramoto N, Nakamura K, Shiga T, Shirakawa T, Matsuo M, Ogasawara M, Nishino I, Matsuwaki T, Nishihara M, Yamanouchi K.
Sci Rep. 2020 Oct 12;10(1):16385. doi: 10.1038/s41598-020-73315-6.
Additional strain information