NBRP Rat No: 0938 |
Strain name: WIC-Cdkn2aem1Kyhs |
Commmon Name: p16欠損ラット |
Rat Genome Database |
Principal Investigator: |
Keitaro Yamanouchi The University of Tokyo 1-1-1, Yayoi, Bunkyo-ku, 113-8657 Tokyo Japan |
Tel: 03-5841-5386 Fax: 03-5841-8017 |
Email: akeita@g.ecc.u-tokyo.ac.jp |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
白 |
Inbred Generations |
6 |
Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Cellular senescence-mediated exacerbation of Duchenne muscular dystrophy. Sugihara H,Teramoto N, Nakamura K, Shiga T, Shirakawa T, Matsuo M, Ogasawara M, Nishino I,Matsuwaki T, Nishihara M, Yamanouchi K. Sd Rep.2020 Oct 12;10(1):16385. doi:10.1038/s41598-020-73315-6. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE,an acknowledgment to the DEPOSITOR is requested. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
p16Cdkn2a |
Origin |
A 7-bp deletion in exon 1 of the Cdkn2a (p16) gene was introduced by the CRISPR/Cas9. Genetic background is Iar:Wistar-Imamichi (Institute for Animal Reproduction). |
Strain characteristics |
Introducing the deletion mutation in the Cdkn2a (p16) gene into the background of DMD rats (muscular dystrophy model rats) improves muscle pathology. |
Breeding Conditions |
Maintained by natural mating of heterozygous females and males. |
Genotyping |
Genotyping by PCR.
Primer F: CACTGAATCTCCGAGAGGAAGG, Primer R: ATTACCTGGGGTATACATTTCATGC.
PCR conditions: Using KOD FX Neo. 94℃ 5 min, x 1 cycle 98℃ 10 sec, 58℃ 30 sec, 68℃ 40 sec x 38 cycles.
To analyze the size of DNA samples, use the Microchip Electrophoresis System for DNA/RNA Analysis (MultiNA). |
References |
Cellular senescence-mediated exacerbation of Duchenne muscular dystrophy.
Sugihara H, Teramoto N, Nakamura K, Shiga T, Shirakawa T, Matsuo M, Ogasawara M, Nishino I, Matsuwaki T, Nishihara M, Yamanouchi K.
Sci Rep. 2020 Oct 12;10(1):16385. doi: 10.1038/s41598-020-73315-6. |
Additional strain information |
|
|