Strain information
 NBRP Rat No: 0862  Strain name: W;WIAR-Izumo1em1Osb  Commmon Name: Izumo1 KO, Izumo1 {em1 Osb} Rat Genome Database
Principal Investigator:  Masahito Ikawa  Osaka University       3-1 Yamadaoka    565-0871 Suita-shi Osaka     JAPAN
Tel: 06-6879-8375    Fax: 06-6879-8376 Email: mta-egr@biken.osaka-u.ac.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  albino
Inbred Generations  情報なし
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Matsumura T, Noda T, Satouh Y, Morohoshi A, Yuri S, Ogawa M, Lu Y, Isotani A, #Ikawa M. Sperm IZUMO1 Is Required for Binding Preceding Fusion With Oolemma in Mice and Rats. Front Cell DevBiol. 2022 Jan 12;9:810118. doi: 10.3389/fcell.2021.810118. eCollection 2021. https://pubmed.ncbi.nlm.nih.gov/35096839/
The RECIPIENT of BIOLOGICAL RESOURCE shall obtaina prior written consent use of it from the DEPOSITOR. RECOPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University.In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following Literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Izumo1 (izumo sperm-egg fusion 1)
Origin Izumo1 KO strain was established by CRISPR/Cas9 system using inbred WIAR (SLC, Inc.). sgRNA:GGTGGCTGCAATAAAGACTT, PAM sequence：TGG. A 7-bp deletion（CTTTGGA）after start codon (Met) in exon2 of Izumo1 gene was detected. After establishment of WIAR background KO rats, this strain was mated with Slc:Wistar (mix background).
Strain characteristics Izumo1-deficient male rats are infertile. In female rats, no specific phenotype is observed.
Breeding Conditions Maintained by mating betweeen heterozygous or homozygous females and heterozygous males.
Genotyping 7 bp-deletion is identified by PCR and sequencing. PCRreaction mixtures tube (total 15 ul)： DW 3.5 μl, 2×Buffer 7.5 ul, 2mM dNTP 3 µl, primer #1 50pmol/ul 0.15 ul, Primer #2 50pmol/ul 0.15 ul, KOD Fx Neo polymerase（TOYOBO) 0.2 ul, DNA 0.5 ul. cycling condition: 94 ℃2 min, (94 ℃ 0.5 min,6 5 ℃ 0.5 min, 72 ℃ 0.5min)× 40 cycle, 72 ℃ 2 min, 16 ℃ ∞. 　 primer #1 name rIzumo-Fw (22mer) 5’-tgtttagcaccctcctccctgc-3', primer #2 name rIzumo-Rv (28mer)5’-agagagtatgtatctctgcctgtcctgg -3'. primer set product size: primer #1 ⇔ primer #2 551 bp (wild)
References Matsumura T, Noda T, Satouh Y, Morohoshi A, Yuri S, Ogawa M, Lu Y, Isotani A, #Ikawa M. Sperm IZUMO1 Is Required for Binding Preceding Fusion With Oolemma in Mice and Rats. Front Cell Dev Biol. 2022 Jan 12;9:810118. doi: 10.3389/fcell.2021.810118. eCollection 2021.
Additional strain information