Usage Restrictions
Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci Rep.(2021) 11:20836
Origin
Genome editing was performed using the rGONAD method. Three different lines of KO rats exist due to differences in protein expression (all lines will be published in a paper). The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan).
Strain characteristics
Rats that develop human Alport syndrome due to deletion of the Col4a5 gene on the X chromosome (due to insertion of a 20 bp stop codon). Col4α5 KO rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age.
Breeding Conditions
Maintained by mating hemizygous males with wild-type females or wild-type males with heterozygous females.
Genotyping
Determined by PCR and gel electrophoresis.
Wild-type: 277-bp, mutant: 297-bp.
Primers: GCTCTCTCTTCCCAATAACCCCT, CAATTTTGACTTCCCTGGGCCA
References
Namba M, Kobayashi T, Kohno M, Koyano T, Hirose T, Fukushima M, Matsuyama M.
Creation of X-linked Alport syndrome rat model with Col4a5 deficiency.
Sci Rep. 2021 Oct 21;11(1):20836. doi: 10.1038/s41598-021-00354-y.