Strain information
 NBRP Rat No: 0962  Strain name: WKY-Col4a5em1Matsu  Commmon Name: WKY-Col4a5-KO Rat Genome Database
Principal Investigator:  Makoto Matsuyama   Shigei Medical Research Institute       2117 Yamada, Minami-ku, Okayama    701-0202 Okayama     Japan
Tel: 086-282-3113    Fax: 086-282-3115 Email: matsuyama@shigei.or.jp
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  
Inbred Generations  F5
Usage Restrictions  Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci Rep.(2021) 11:20836
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 腎臓病
 Control Strain  Marker Strain
Gene Affected Col4a5
Origin Genome editing was performed using the rGONAD method. Three different lines of KO rats exist due to differences in protein expression (all lines will be published in a paper). The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan).
Strain characteristics Rats that develop human Alport syndrome due to deletion of the Col4a5 gene on the X chromosome (due to insertion of a 20 bp stop codon). Col4α5 KO rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age.
Breeding Conditions Maintained by mating hemizygous males with wild-type females or wild-type males with heterozygous females.
Genotyping Determined by PCR and gel electrophoresis. Wild-type: 277-bp, mutant: 297-bp. Primers: GCTCTCTCTTCCCAATAACCCCT, CAATTTTGACTTCCCTGGGCCA
References Namba M, Kobayashi T, Kohno M, Koyano T, Hirose T, Fukushima M, Matsuyama M.
Creation of X-linked Alport syndrome rat model with Col4a5 deficiency.
Sci Rep. 2021 Oct 21;11(1):20836. doi: 10.1038/s41598-021-00354-y.
Additional strain information