NBRP Rat No: 0964 |
Strain name: WKY-Col4a5em3Matsu |
Commmon Name: WKY-Col4a5-del |
Rat Genome Database |
Principal Investigator: |
Makoto Matsuyama Shigei Medical Research Institute 2117 Yamada, Minami-ku, Okayama 701-0202 Okayama Japan |
Tel: 086-282-3113 Fax: 086-282-3115 |
Email: matsuyama@shigei.or.jp |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
|
Inbred Generations |
F5 |
Usage Restrictions |
Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci Rep. (2021) 11:20836 |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
Col4a5 |
Origin |
Genome editing was performed using the rGONAD method. Three different lines of KO rats exist due to differences in protein expression (all lines will be published in a paper). The genetic background is WKY/NCrlCrlj (Charles River Laboratories Japan). |
Strain characteristics |
Rats that develop human Alport syndrome due to deletion of the Col4a5 gene on the X chromosome (deletion of 56 bp containing the first methionine). Col4α5 KO rats have urinary protein and hematuria from early on, and males begin to die at 18 weeks of age and all die by 28 weeks of age. |
Breeding Conditions |
Maintained by mating hemizygous males with wild-type females or wild-type males with heterozygous females. |
Genotyping |
Determined by PCR and gel electrophoresis.
Wild-type: 277-bp, mutant: 221-bp.
Primers: GCTCTCTTCCCAATAACCCCT, CAATTTTGACTTCCCTGGCCA |
References |
Namba M, Kobayashi T, Kohno M, Koyano T, Hirose T, Fukushima M, Matsuyama M.
Creation of X-linked Alport syndrome rat model with Col4a5 deficiency.
Sci Rep. 2021 Oct 21;11(1):20836. doi: 10.1038/s41598-021-00354-y. |
Additional strain information |
|
|