NBRP Rat No: 0967 |
Strain name: SHRSP.SHR-(D1Got82-D1Rat97)/Izm |
Commmon Name: Pr1.102, SPrch1.102 |
Rat Genome Database |
Principal Investigator: |
Toru Nabika, Hiroki Ohara Shimane University, School of Medicine 89-1 Enya-cho, 693-8501 Izumo-City, Shimane-Prefecture Japan |
Tel: 0853-20-2407 Fax: 0853-20-2135 |
Email: oharah@med.shimane-u.ac.jp (大原先生) |
Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
Coat Color |
白 |
Inbred Generations |
|
Usage Restrictions |
Recipients are requested to obtain a written approval of the depositor. |
Genetic Status |
|
Comercial Availability |
|
|
Research Category |
|
Gene Affected |
|
Origin |
A subcongenic strain generated by backcrossing SHRSP.SHR-(D1Mgh5-D1Got87)/Izm (NBRP Rat No.0709) to SHRSP/Izm. A segment of the QTL region of chromosome 1 involved in salt-induced stroke (Niiya et al. Sci Rep. 2018; 8; 9403) has been exchanged. |
Strain characteristics |
More resistant than SHRSP/Izm in stroke susceptibility testing under 1% saline loading conditions. Blood pressure (by tail-cuff method) at 12 weeks is comparable to SHRSP/Izm. |
Breeding Conditions |
Maintained by homozygous sibling mating. Reproductive performance is good. |
Genotyping |
Determined by PCR. Primers are as follows.
D1Got82 (F: CCAAAAGTATGAGGCACGATA, R: ATTGTGCCATGGAGGCTCTCTG), D1Rat97 (F: AGGGGATTAGAAGCCTCTGC, R: TTCTCCCCTTTTTTCAGTCCCT) |
References |
Wang M, Ohara H, Egawa M, Fukunaga S, Matsuo H, Ge ZR, Nabika T.
A 3-Mbp fragment on rat chromosome 1 affects susceptibility both to stroke and kidney injury under salt loading in the stroke-prone spontaneously hypertensive rat: a genetic approach using multiple congenic strains.
Exp Anim. 2022 Mar 29. doi: 10.1538/expanim.21-0189. |
Additional strain information |
|
|