| NBRP Rat No: 0955 |
Strain name: WIC.WDB-Kiss1tm1(tdTomato)Nurep |
Commmon Name: Kiss1-tdTomato |
Rat Genome Database |
| Principal Investigator: |
Hiroko Tsukamura Tokai National Higher Education and Research System Furou-cho, Chikusa-ku 464-8601 Nagoya-shi Japan |
| Tel: 052-789-5870 Fax: 052-789-4072 |
Email: uenoyama@nagoya-u.jp(上野山 賀久 先生) |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白 |
| Inbred Generations |
N13 (February, 2021) |
| Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Uenoyama Y, Nakamura S, Hayakawa Y, Ikegami K, Wananabe Y, Deura C, Minabe S, Tomikawa J, Goto T, Ieda N, Inoue N, Sanbo M, Tamura C, Hirabayashi M, Maeda KI, Tuskamura H. Lack of pulse and surge modes and glutamatergic stimulation of LH release in Kiss1 knockout rats. J Neuroendocrinol 2015; 27; 187-197. The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. If the RECIPIENT wishes to use the BIOLOGICAL RESOURCE for commercial purposes, the RECIPIENT shall reach an agreement with the DEPOSITOR on terms and conditiones of use of BIOLOGICAL RESOURCE and shall obtain a prior written consent from the DEPOSITOR. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Kiss1 |
| Origin |
Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). A targeting vector for the Kiss1 gene (tdTomato/puromycin N-acetyltransferase) was introduced into ES cells (WDB/Nips-ES1/Nips) by electroporation. This strain has been backcrossed to Wistar-Imamichi rats (Iar:Wistar-Imamichi, National Institute of Animal Reproduction). |
| Strain characteristics |
Kisspeptin neurons in the hypothalamus express red fluorescent tdTomato. Homozygous rats are infertile due to gonadotrophin deficiency. |
| Breeding Conditions |
Homozygous rats are infertile due to gonadotrophin deficiency. Maintain as heterozygous. |
| Genotyping |
Determined by PCR and gel electrophoresis. Wild-type: 294 bp, mutant: 936 bp, primers (final concentration 200 nM), F1 (#798): ccttgtttggggcttatcct, R1 (#799): cttttttccgggatggtgtgta, R2 (#620): gatgacggccatgttgtttt, KOD-Fx, 35 cycles, 95°C 2 min, 98°C 20 sec, 60°C 30 sec, 68°C 1 min, 68°C 10 min, 4°C |
| References |
Uenoyama Y, Nakamura S, Hayakawa Y, Ikegami K, Watanabe Y, Deura C, Minabe S, Tomikawa J, Goto T, Ieda N, Inoue N, Sanbo M, Tamura C, Hirabayashi M, Maeda KI, Tsukamura H.
Lack of pulse and surge modes and glutamatergic stimulation of LH release in Kiss1 knockout rats.
J Neuroendocrinol 2015; 27:187-197. |
| Additional strain information |
|
|
|