Strain information
 NBRP Rat No: 0955  Strain name: WIC.WDB-Kiss1tm1(tdTomato)Nurep  Commmon Name: Kiss1-tdTomato Rat Genome Database
Principal Investigator:  Hiroko Tsukamura  Tokai National Higher Education and Research System       Furou-cho, Chikusa-ku    464-8601 Nagoya-shi     Japan
Tel: 052-789-5870    Fax: 052-789-4072 Email: uenoyama@nagoya-u.jp（上野山　賀久　先生）
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  N13 (February, 2021)
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Uenoyama Y, Nakamura S, Hayakawa Y, Ikegami K, Wananabe Y, Deura C, Minabe S, Tomikawa J, Goto T, Ieda N, Inoue N, Sanbo M, Tamura C, Hirabayashi M, Maeda KI, Tuskamura H.
Lack of pulse and surge modes and glutamatergic stimulation of LH release in Kiss1 knockout rats. J Neuroendocrinol 2015; 27; 187-197.
The recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
If the RECIPIENT wishes to use the BIOLOGICAL RESOURCE for commercial purposes, the RECIPIENT shall reach an agreement with the DEPOSITOR on terms and conditiones of use of BIOLOGICAL RESOURCE and shall obtain a prior written consent from the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Kiss1
Origin Kiss1 knockout rats were generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences). A targeting vector for the Kiss1 gene (tdTomato/puromycin N-acetyltransferase) was introduced into ES cells (WDB/Nips-ES1/Nips) by electroporation. This strain has been backcrossed to Wistar-Imamichi rats (Iar:Wistar-Imamichi, National Institute of Animal Reproduction).
Strain characteristics Kisspeptin neurons in the hypothalamus express red fluorescent tdTomato. Homozygous rats are infertile due to gonadotrophin deficiency.
Breeding Conditions Homozygous rats are infertile due to gonadotrophin deficiency. Maintain as heterozygous.
Genotyping Determined by PCR and gel electrophoresis. Wild-type: 294 bp, mutant: 936 bp, primers (final concentration 200 nM), F1 (#798): ccttgtttggggcttatcct, R1 (#799): cttttttccgggatggtgtgta, R2 (#620): gatgacggccatgttgtttt, KOD-Fx, 35 cycles, 95°C 2 min, 98°C 20 sec, 60°C 30 sec, 68°C 1 min, 68°C 10 min, 4°C
References Uenoyama Y, Nakamura S, Hayakawa Y, Ikegami K, Watanabe Y, Deura C, Minabe S, Tomikawa J, Goto T, Ieda N, Inoue N, Sanbo M, Tamura C, Hirabayashi M, Maeda KI, Tsukamura H.
Lack of pulse and surge modes and glutamatergic stimulation of LH release in Kiss1 knockout rats.
J Neuroendocrinol 2015; 27:187-197.
Additional strain information