Strain information
 NBRP Rat No: 0956  Strain name: WIC;WDB-Kiss1tm1Nurep  Commmon Name: Kiss1-floxed Rat Genome Database
Principal Investigator:  Hiroko Tsukamura  Tokai National Higher Education and Research System       Furou-cho, Chikusa-ku    464-8601 Nagoya-shi     Japan
Tel: 052-789-5870    Fax: 052-789-4072 Email: uenoyama@nagoya-u.jp（上野山　賀久　先生）
Preservation Status:   Embryo        Sperm       Living Animals
Coat Color  白
Inbred Generations  N3 (February, 2021)
Usage Restrictions  In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literatures designated by the DEPOSITOR is requested.
Nagae M, Uenoyama Y, Okamoto S, Tsuchida H, Ikegami K, Goto T, Majarune S, Nakamura S, Sanbo M, Hirabayashi M, Kobayashi K, Inoue N, Tsukamura H. Direct evidence that KNDy neurons maintain gonadotropin pulses and folliculogenesis as the GnRH pulse generator. Proc Nat1 Acad Sci USA2021;118: e2009156118.
The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR.
If the RECIPIENT wishes to use the BIOLOGICAL RESOURCE for commercial purposes, the RECIPIENT shall reach an agreement with the DEPOSITOR on terms and conditions of use of BIOLOGICAL RESOURCE and shall obtain a prior written consent from the DEPOSITOR.
Genetic Status
 Inbred  Segregating  Congenic  Consomic  Recombinant
 Coisogenic  Spont. Mutant  Transgene  Ind. Mutant  Category Other 
Comercial Availability
Research Category
 Diabetes Obesity  Neurobiology  Ophthalmology  Dentistry  Cardio Hypertension
 Cancer  Metabolism  Otorhinology  Immunology  Infectious
 Osteosis  Internal Organ  Dermatology  Reproduction  Development
 Behavior  Hematology  Urology  Pharmacology  Research Area Others 
 Control Strain  Marker Strain
Gene Affected Kiss1
Origin This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction).
Strain characteristics The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase.
Breeding Conditions This strain can be bred either heterozygous or homozygous.
Genotyping Determined by PCR and gel electrophoresis. Wild-type: 566 bp, mutant: 2,208 bp, primers (final concentration 200 nM), F1 (#1424): ggaagtctgagctggtgtcc, R1 (#1006): agtaccgattttggcacca, KOD-Fx, 35 cycles, 94°C 2 min, 98°C 15 sec, 60°C 30 sec, 68°C 2 min, 68°C 10 min, 4°C
References Nagae M, Uenoyama Y, Okamoto S, Tsuchida H, Ikegami K, Goto T, Majarune S, Nakamura S, Sanbo M, Hirabayashi M, Kobayashi K, Inoue N, Tsukamura H.
Direct evidence that KNDy neurons maintain gonadotropin pulse and folliculogenesis as the GnRH pulse generator.
Proc Natl Acad Sci U S A 2020; doi: 10.1073/pnas.2009156118.
Additional strain information