| NBRP Rat No: 0956 |
Strain name: WIC;WDB-Kiss1tm1Nurep |
Commmon Name: Kiss1-floxed |
Rat Genome Database |
| Principal Investigator: |
Hiroko Tsukamura Tokai National Higher Education and Research System Furou-cho, Chikusa-ku 464-8601 Nagoya-shi Japan |
| Tel: 052-789-5870 Fax: 052-789-4072 |
Email: uenoyama@nagoya-u.jp(上野山 賀久 先生) |
| Preservation Status: |
Embryo Sperm Living Animals |
![]() |
![]() |
| Coat Color |
白 |
| Inbred Generations |
N3 (February, 2021) |
| Usage Restrictions |
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literatures designated by the DEPOSITOR is requested. Nagae M, Uenoyama Y, Okamoto S, Tsuchida H, Ikegami K, Goto T, Majarune S, Nakamura S, Sanbo M, Hirabayashi M, Kobayashi K, Inoue N, Tsukamura H. Direct evidence that KNDy neurons maintain gonadotropin pulses and folliculogenesis as the GnRH pulse generator. Proc Nat1 Acad Sci USA2021;118: e2009156118. The following specific terms and conditions are requested by the DEPOSITOR. In this event, the recipient of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. If the RECIPIENT wishes to use the BIOLOGICAL RESOURCE for commercial purposes, the RECIPIENT shall reach an agreement with the DEPOSITOR on terms and conditions of use of BIOLOGICAL RESOURCE and shall obtain a prior written consent from the DEPOSITOR. |
| Genetic Status |
|
| Comercial Availability |
|
|
| Research Category |
|
| Gene Affected |
Kiss1 |
| Origin |
This strain was generated by K.I. Maeda (The University of Tokyo), H. Tsukamura, Y. Uenoyama, N. Inoue (Nagoya University), and M. Hirabayashi (National Institute for Physiological Sciences) for the purpose of producing conditional knockout rats of the Kiss1 gene in the hypothalamus. The targeting vector (loxP, Kiss1[exons 2 and 3], PGK promoter-neo, loxP) was introduced by electroporation targeting the Kiss1 gene in ES cells (WDB/Nips-ES1/Nips). Crossed with and maintained by the Wistar-Imamichi rats (Iar:Wistar-Imamichi, Institute for Animal Reproduction). |
| Strain characteristics |
The kisspeptin gene (Kiss1) is knocked out conditonally by the Cre recombinase. |
| Breeding Conditions |
This strain can be bred either heterozygous or homozygous. |
| Genotyping |
Determined by PCR and gel electrophoresis. Wild-type: 566 bp, mutant: 2,208 bp, primers (final concentration 200 nM), F1 (#1424): ggaagtctgagctggtgtcc, R1 (#1006): agtaccgattttggcacca, KOD-Fx, 35 cycles, 94°C 2 min, 98°C 15 sec, 60°C 30 sec, 68°C 2 min, 68°C 10 min, 4°C |
| References |
Nagae M, Uenoyama Y, Okamoto S, Tsuchida H, Ikegami K, Goto T, Majarune S, Nakamura S, Sanbo M, Hirabayashi M, Kobayashi K, Inoue N, Tsukamura H.
Direct evidence that KNDy neurons maintain gonadotropin pulse and folliculogenesis as the GnRH pulse generator.
Proc Natl Acad Sci U S A 2020; doi: 10.1073/pnas.2009156118. |
| Additional strain information |
|
|
|